[English] 日本語
Yorodumi
- PDB-7ay1: Cryo-EM structure of USP1-UAF1 bound to mono-ubiquitinated FANCD2... -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 7ay1
TitleCryo-EM structure of USP1-UAF1 bound to mono-ubiquitinated FANCD2, and FANCI
Components
  • (Fanconi anemia group ...) x 2
  • DNA (61-MER)
  • Ubiquitin carboxyl-terminal hydrolase 1
  • Ubiquitin-60S ribosomal protein L40
  • WD repeat-containing protein 48
KeywordsHYDROLASE / deubiquitination / specificity / DNA repair / Fanconi Anemia
Function / homology
Function and homology information


regulation of protein monoubiquitination / positive regulation of error-prone translesion synthesis / Signaling by cytosolic PDGFRA and PDGFRB fusion proteins / regulation of CD40 signaling pathway / gamete generation / monoubiquitinated protein deubiquitination / regulation of regulatory T cell differentiation / homologous chromosome pairing at meiosis / neuronal stem cell population maintenance / double-strand break repair involved in meiotic recombination ...regulation of protein monoubiquitination / positive regulation of error-prone translesion synthesis / Signaling by cytosolic PDGFRA and PDGFRB fusion proteins / regulation of CD40 signaling pathway / gamete generation / monoubiquitinated protein deubiquitination / regulation of regulatory T cell differentiation / homologous chromosome pairing at meiosis / neuronal stem cell population maintenance / double-strand break repair involved in meiotic recombination / brain morphogenesis / deubiquitinase activator activity / response to insecticide / DNA repair complex / mitotic intra-S DNA damage checkpoint signaling / skeletal system morphogenesis / skin development / seminiferous tubule development / homeostasis of number of cells / Peptide chain elongation / Selenocysteine synthesis / Formation of a pool of free 40S subunits / Eukaryotic Translation Termination / embryonic organ development / SRP-dependent cotranslational protein targeting to membrane / Response of EIF2AK4 (GCN2) to amino acid deficiency / protein deubiquitination / single fertilization / Viral mRNA Translation / Nonsense Mediated Decay (NMD) independent of the Exon Junction Complex (EJC) / regulation of DNA repair / GTP hydrolysis and joining of the 60S ribosomal subunit / L13a-mediated translational silencing of Ceruloplasmin expression / response to UV / Major pathway of rRNA processing in the nucleolus and cytosol / interstrand cross-link repair / positive regulation of double-strand break repair via homologous recombination / Nonsense Mediated Decay (NMD) enhanced by the Exon Junction Complex (EJC) / condensed chromosome / DNA polymerase binding / Maturation of protein E / Maturation of protein E / ER Quality Control Compartment (ERQC) / Myoclonic epilepsy of Lafora / FLT3 signaling by CBL mutants / IRAK2 mediated activation of TAK1 complex / Prevention of phagosomal-lysosomal fusion / Alpha-protein kinase 1 signaling pathway / Glycogen synthesis / IRAK1 recruits IKK complex / IRAK1 recruits IKK complex upon TLR7/8 or 9 stimulation / Endosomal Sorting Complex Required For Transport (ESCRT) / Membrane binding and targetting of GAG proteins / Negative regulation of FLT3 / Regulation of TBK1, IKKε (IKBKE)-mediated activation of IRF3, IRF7 / PTK6 Regulates RTKs and Their Effectors AKT1 and DOK1 / Regulation of TBK1, IKKε-mediated activation of IRF3, IRF7 upon TLR3 ligation / IRAK2 mediated activation of TAK1 complex upon TLR7/8 or 9 stimulation / Constitutive Signaling by NOTCH1 HD Domain Mutants / NOTCH2 Activation and Transmission of Signal to the Nucleus / TICAM1,TRAF6-dependent induction of TAK1 complex / TICAM1-dependent activation of IRF3/IRF7 / APC/C:Cdc20 mediated degradation of Cyclin B / cytosolic ribosome / Regulation of FZD by ubiquitination / Downregulation of ERBB4 signaling / APC-Cdc20 mediated degradation of Nek2A / p75NTR recruits signalling complexes / InlA-mediated entry of Listeria monocytogenes into host cells / TRAF6 mediated IRF7 activation in TLR7/8 or 9 signaling / NF-kB is activated and signals survival / TRAF6-mediated induction of TAK1 complex within TLR4 complex / Regulation of pyruvate metabolism / Pexophagy / Regulation of innate immune responses to cytosolic DNA / Downregulation of ERBB2:ERBB3 signaling / NRIF signals cell death from the nucleus / Regulation of PTEN localization / VLDLR internalisation and degradation / positive regulation of epithelial cell proliferation / positive regulation of protein ubiquitination / Activated NOTCH1 Transmits Signal to the Nucleus / Synthesis of active ubiquitin: roles of E1 and E2 enzymes / protein modification process / Translesion synthesis by REV1 / TICAM1, RIP1-mediated IKK complex recruitment / Regulation of BACH1 activity / Translesion synthesis by POLK / InlB-mediated entry of Listeria monocytogenes into host cell / JNK (c-Jun kinases) phosphorylation and activation mediated by activated human TAK1 / Activation of IRF3, IRF7 mediated by TBK1, IKKε (IKBKE) / MAP3K8 (TPL2)-dependent MAPK1/3 activation / Downregulation of TGF-beta receptor signaling / Translesion synthesis by POLI / Josephin domain DUBs / IKK complex recruitment mediated by RIP1 / Gap-filling DNA repair synthesis and ligation in GG-NER / PINK1-PRKN Mediated Mitophagy / response to gamma radiation / TGF-beta receptor signaling in EMT (epithelial to mesenchymal transition)
Similarity search - Function
WDR48/Bun107 / Ubiquitin specific peptidase 1 / : / Domain of unknown function (DUF3337) / Fanconi anemia group I protein / FANCI solenoid 1 cap / FANCI solenoid 1 domain / FANCI helical domain 1 / FANCI helical domain 2 / FANCI solenoid 3 domain ...WDR48/Bun107 / Ubiquitin specific peptidase 1 / : / Domain of unknown function (DUF3337) / Fanconi anemia group I protein / FANCI solenoid 1 cap / FANCI solenoid 1 domain / FANCI helical domain 1 / FANCI helical domain 2 / FANCI solenoid 3 domain / FANCI solenoid 4 domain / FANCI solenoid 2 domain / FANCI solenoid 1 cap / FANCI solenoid 1 / FANCI solenoid 2 / FANCI solenoid 3 / FANCI solenoid 4 / FANCI helical domain 1 / FANCI helical domain 2 / Fanconi anaemia protein FANCD2 / Fanconi anaemia protein FancD2 nuclease / : / Ubiquitin specific protease (USP) domain signature 2. / Ubiquitin specific protease (USP) domain signature 1. / Ubiquitin specific protease, conserved site / Peptidase C19, ubiquitin carboxyl-terminal hydrolase / Ubiquitin carboxyl-terminal hydrolase / Ubiquitin specific protease domain / Ubiquitin specific protease (USP) domain profile. / Ribosomal L40e family / Ribosomal_L40e / Ribosomal protein L40e / Ribosomal protein L40e superfamily / Phosphatidylinositol 3-kinase Catalytic Subunit; Chain A, domain 1 / Papain-like cysteine peptidase superfamily / Ubiquitin-like (UB roll) / : / Ubiquitin domain signature. / Ubiquitin conserved site / Ubiquitin domain / Ubiquitin family / Ubiquitin homologues / Ubiquitin domain profile. / Ubiquitin-like domain / WD domain, G-beta repeat / Ubiquitin-like domain superfamily / G-protein beta WD-40 repeat / WD40 repeat, conserved site / Trp-Asp (WD) repeats signature. / Trp-Asp (WD) repeats profile. / Trp-Asp (WD) repeats circular profile. / WD40 repeats / WD40 repeat / WD40-repeat-containing domain superfamily / WD40/YVTN repeat-like-containing domain superfamily / Roll / Alpha Beta
Similarity search - Domain/homology
DNA / DNA (> 10) / Ubiquitin carboxyl-terminal hydrolase 1 / Ubiquitin-ribosomal protein eL40 fusion protein / WD repeat-containing protein 48 / Fanconi anemia group D2 protein / Fanconi anemia group I protein
Similarity search - Component
Biological speciesHomo sapiens (human)
synthetic construct (others)
MethodELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 3.7 Å
AuthorsRennie, M.L. / Arkinson, C. / Walden, H.
Funding support United Kingdom, 2items
OrganizationGrant numberCountry
European Research Council (ERC)ERC-2015-CoG-681582 United Kingdom
Medical Research Council (MRC, United Kingdom)MC_UU_12016/12 United Kingdom
Citation
Journal: Nat Struct Mol Biol / Year: 2021
Title: Structural basis of FANCD2 deubiquitination by USP1-UAF1.
Authors: Martin L Rennie / Connor Arkinson / Viduth K Chaugule / Rachel Toth / Helen Walden /
Abstract: Ubiquitin-specific protease 1 (USP1) acts together with the cofactor UAF1 during DNA repair processes to specifically remove monoubiquitin signals. One substrate of the USP1-UAF1 complex is the ...Ubiquitin-specific protease 1 (USP1) acts together with the cofactor UAF1 during DNA repair processes to specifically remove monoubiquitin signals. One substrate of the USP1-UAF1 complex is the monoubiquitinated FANCI-FANCD2 heterodimer, which is involved in the repair of DNA interstrand crosslinks via the Fanconi anemia pathway. Here we determine structures of human USP1-UAF1 with and without ubiquitin and bound to monoubiquitinated FANCI-FANCD2. The crystal structures of USP1-UAF1 reveal plasticity in USP1 and key differences to USP12-UAF1 and USP46-UAF1, two related proteases. A cryo-EM reconstruction of USP1-UAF1 in complex with monoubiquitinated FANCI-FANCD2 highlights a highly orchestrated deubiquitination process, with USP1-UAF1 driving conformational changes in the substrate. An extensive interface between UAF1 and FANCI, confirmed by mutagenesis and biochemical assays, provides a molecular explanation for the requirement of both proteins, despite neither being directly involved in catalysis. Overall, our data provide molecular details of USP1-UAF1 regulation and substrate recognition.
#1: Journal: Biorxiv / Year: 2020
Title: Structural basis of FANCD2 deubiquitination by USP1-UAF1
Authors: Rennie, M.L. / Arkinson, C. / Chaugule, V.K. / Toth, R. / Walden, H.
History
DepositionNov 10, 2020Deposition site: PDBE / Processing site: PDBE
Revision 1.0Mar 24, 2021Provider: repository / Type: Initial release
Revision 1.1Apr 7, 2021Group: Database references / Category: citation / citation_author
Revision 1.2Apr 14, 2021Group: Database references / Category: citation / Item: _citation.pdbx_database_id_PubMed / _citation.title
Revision 1.3Apr 28, 2021Group: Database references / Category: citation
Item: _citation.journal_volume / _citation.page_first / _citation.page_last
Revision 2.0Jul 27, 2022Group: Advisory / Database references ...Advisory / Database references / Polymer sequence / Source and taxonomy / Structure summary
Category: database_2 / entity ...database_2 / entity / entity_poly / entity_poly_seq / entity_src_gen / pdbx_poly_seq_scheme / pdbx_unobs_or_zero_occ_residues / struct_ref_seq_dif
Item: _database_2.pdbx_DOI / _database_2.pdbx_database_accession ..._database_2.pdbx_DOI / _database_2.pdbx_database_accession / _entity.formula_weight / _entity.pdbx_mutation / _entity_poly.pdbx_seq_one_letter_code / _entity_poly.pdbx_seq_one_letter_code_can / _entity_poly_seq.mon_id / _entity_src_gen.gene_src_common_name / _pdbx_poly_seq_scheme.mon_id / _pdbx_unobs_or_zero_occ_residues.auth_comp_id / _pdbx_unobs_or_zero_occ_residues.label_comp_id
Revision 2.1Oct 23, 2024Group: Data collection / Database references / Structure summary
Category: chem_comp_atom / chem_comp_bond ...chem_comp_atom / chem_comp_bond / citation / em_admin / pdbx_entry_details / pdbx_modification_feature
Item: _citation.journal_id_ISSN / _em_admin.last_update / _pdbx_entry_details.has_protein_modification

-
Structure visualization

Movie
  • Deposited structure unit
  • Imaged by Jmol
  • Download
  • Superimposition on EM map
  • EMDB-11934
  • Imaged by UCSF Chimera
  • Download
Movie viewer
Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
A: Fanconi anemia group I protein
B: Fanconi anemia group D2 protein
C: Ubiquitin-60S ribosomal protein L40
D: Ubiquitin carboxyl-terminal hydrolase 1
E: WD repeat-containing protein 48
S: DNA (61-MER)
T: DNA (61-MER)
hetero molecules


Theoretical massNumber of molelcules
Total (without water)501,0708
Polymers501,0057
Non-polymers651
Water00
1


  • Idetical with deposited unit
  • defined by author
  • Evidence: gel filtration, USP1, UAF1, FANCI, and FANCD2ub all coelute
TypeNameSymmetry operationNumber
identity operation1_5551

-
Components

-
Fanconi anemia group ... , 2 types, 2 molecules AB

#1: Protein Fanconi anemia group I protein / Protein FACI


Mass: 150459.125 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: FANCI, KIAA1794 / Cell line (production host): Sf21 / Production host: Spodoptera frugiperda (fall armyworm) / References: UniProt: Q9NVI1
#2: Protein Fanconi anemia group D2 protein / Protein FACD2


Mass: 164623.828 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: FANCD2, FACD / Cell line (production host): Sf21 / Production host: Spodoptera frugiperda (fall armyworm) / References: UniProt: Q9BXW9

-
Protein , 3 types, 3 molecules CDE

#3: Protein Ubiquitin-60S ribosomal protein L40 / CEP52 / Ubiquitin A-52 residue ribosomal protein fusion product 1


Mass: 8875.125 Da / Num. of mol.: 1 / Mutation: GPGS expression tag
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: UBA52, UBCEP2 / Cell line (production host): Sf21 / Production host: Spodoptera frugiperda (fall armyworm) / References: UniProt: P62987
#4: Protein Ubiquitin carboxyl-terminal hydrolase 1 / Deubiquitinating enzyme 1 / hUBP / Ubiquitin thioesterase 1 / Ubiquitin-specific-processing protease 1


Mass: 88390.273 Da / Num. of mol.: 1 / Mutation: C90S, G670A, G671A
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: USP1 / Cell line (production host): Sf21 / Production host: Spodoptera frugiperda (fall armyworm) / References: UniProt: O94782, ubiquitinyl hydrolase 1
#5: Protein WD repeat-containing protein 48 / USP1-associated factor 1 / WD repeat endosomal protein / p80


Mass: 78300.656 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: WDR48, KIAA1449, UAF1 / Cell line (production host): Sf21 / Production host: Spodoptera frugiperda (fall armyworm) / References: UniProt: Q8TAF3

-
DNA chain / Non-polymers , 2 types, 3 molecules ST

#6: DNA chain DNA (61-MER)


Mass: 5177.820 Da / Num. of mol.: 2 / Source method: obtained synthetically
Details: Arbitrary DNA sequence modelled due to insufficient local resolution to determine sequence register. DNA used TGATCAGAGGTCATTTGAATTCATGGCTTCGAGCTTCATGTAGAGTCGACGGTGCTGGGAT
Source: (synth.) synthetic construct (others)
#7: Chemical ChemComp-ZN / ZINC ION


Mass: 65.409 Da / Num. of mol.: 1 / Source method: obtained synthetically / Formula: Zn

-
Details

Has ligand of interestN
Has protein modificationY

-
Experimental details

-
Experiment

ExperimentMethod: ELECTRON MICROSCOPY
EM experimentAggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction

-
Sample preparation

Component
IDNameTypeEntity IDParent-IDSource
1Enzyme substrate complex of USP1-UAF1 and FANCI-FANCD2ub-dsDNACOMPLEX#1-#60MULTIPLE SOURCES
2Enzyme substrate complex of USP1-UAF1 and FANCI-FANCD2ubCOMPLEX#1-#51RECOMBINANT
3DNACOMPLEX#61RECOMBINANT
Molecular weightValue: 0.49 MDa / Experimental value: NO
Source (natural)
IDEntity assembly-IDOrganismNcbi tax-ID
22Homo sapiens (human)9606
33synthetic construct (others)32630
Source (recombinant)
IDEntity assembly-IDOrganismNcbi tax-ID
22Spodoptera frugiperda (fall armyworm)7108
33synthetic construct (others)32630
Buffer solutionpH: 8
Buffer component
IDConc.NameFormulaBuffer-ID
120 mMTrisC4H11NO31
2150 mMNaClNaCl1
32 mMDTTC4H10O2S21
SpecimenConc.: 4.3 mg/ml / Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES
VitrificationInstrument: FEI VITROBOT MARK IV / Cryogen name: ETHANE / Humidity: 95 % / Chamber temperature: 288 K

-
Electron microscopy imaging

MicroscopyModel: JEOL CRYO ARM 300
Electron gunElectron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: FLOOD BEAM
Electron lensMode: BRIGHT FIELD
Image recordingAverage exposure time: 14.9 sec. / Electron dose: 65 e/Å2 / Detector mode: COUNTING / Film or detector model: DIRECT ELECTRON DE-64 (8k x 8k)
Image scansMovie frames/image: 59

-
Processing

SoftwareName: PHENIX / Version: (1.18_3855:phenix.real_space_refine) / Classification: refinement
EM software
IDNameVersionCategory
4cryoSPARC2.13.2CTF correction
13cryoSPARC2.13.23D reconstruction
CTF correctionType: PHASE FLIPPING AND AMPLITUDE CORRECTION
Particle selectionNum. of particles selected: 249732
SymmetryPoint symmetry: C1 (asymmetric)
3D reconstructionResolution: 3.7 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 391552 / Symmetry type: POINT
RefinementCross valid method: THROUGHOUT
Displacement parametersBiso max: 370.07 Å2 / Biso mean: 65.7212 Å2 / Biso min: 17.11 Å2
Refine LS restraints
Refine-IDTypeDev idealNumber
ELECTRON MICROSCOPYf_bond_d0.00526319
ELECTRON MICROSCOPYf_angle_d0.85435840
ELECTRON MICROSCOPYf_chiral_restr0.0484209
ELECTRON MICROSCOPYf_plane_restr0.0054301
ELECTRON MICROSCOPYf_dihedral_angle_d20.3433822

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more