[English] 日本語
Yorodumi- PDB-7ay1: Cryo-EM structure of USP1-UAF1 bound to mono-ubiquitinated FANCD2... -
+
Open data
-
Basic information
| Entry | Database: PDB / ID: 7ay1 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Title | Cryo-EM structure of USP1-UAF1 bound to mono-ubiquitinated FANCD2, and FANCI | |||||||||
Components |
| |||||||||
Keywords | HYDROLASE / deubiquitination / specificity / DNA repair / Fanconi Anemia | |||||||||
| Function / homology | Function and homology informationregulation of protein monoubiquitination / positive regulation of error-prone translesion synthesis / Signaling by cytosolic PDGFRA and PDGFRB fusion proteins / regulation of CD40 signaling pathway / gamete generation / monoubiquitinated protein deubiquitination / regulation of regulatory T cell differentiation / double-strand break repair involved in meiotic recombination / homologous chromosome pairing at meiosis / neuronal stem cell population maintenance ...regulation of protein monoubiquitination / positive regulation of error-prone translesion synthesis / Signaling by cytosolic PDGFRA and PDGFRB fusion proteins / regulation of CD40 signaling pathway / gamete generation / monoubiquitinated protein deubiquitination / regulation of regulatory T cell differentiation / double-strand break repair involved in meiotic recombination / homologous chromosome pairing at meiosis / neuronal stem cell population maintenance / brain morphogenesis / response to insecticide / deubiquitinase activator activity / DNA repair complex / mitotic intra-S DNA damage checkpoint signaling / skeletal system morphogenesis / skin development / seminiferous tubule development / homeostasis of number of cells / Peptide chain elongation / Selenocysteine synthesis / Formation of a pool of free 40S subunits / protein deubiquitination / Eukaryotic Translation Termination / SRP-dependent cotranslational protein targeting to membrane / Response of EIF2AK4 (GCN2) to amino acid deficiency / embryonic organ development / Viral mRNA Translation / Nonsense Mediated Decay (NMD) independent of the Exon Junction Complex (EJC) / single fertilization / GTP hydrolysis and joining of the 60S ribosomal subunit / L13a-mediated translational silencing of Ceruloplasmin expression / interstrand cross-link repair / Major pathway of rRNA processing in the nucleolus and cytosol / regulation of DNA repair / response to UV / positive regulation of double-strand break repair via homologous recombination / Nonsense Mediated Decay (NMD) enhanced by the Exon Junction Complex (EJC) / condensed chromosome / DNA polymerase binding / Maturation of protein E / Maturation of protein E / ER Quality Control Compartment (ERQC) / Myoclonic epilepsy of Lafora / FLT3 signaling by CBL mutants / Constitutive Signaling by NOTCH1 HD Domain Mutants / IRAK2 mediated activation of TAK1 complex / Prevention of phagosomal-lysosomal fusion / Alpha-protein kinase 1 signaling pathway / Glycogen synthesis / IRAK1 recruits IKK complex / IRAK1 recruits IKK complex upon TLR7/8 or 9 stimulation / Endosomal Sorting Complex Required For Transport (ESCRT) / Membrane binding and targetting of GAG proteins / Negative regulation of FLT3 / Regulation of TBK1, IKKε (IKBKE)-mediated activation of IRF3, IRF7 / PTK6 Regulates RTKs and Their Effectors AKT1 and DOK1 / Regulation of TBK1, IKKε-mediated activation of IRF3, IRF7 upon TLR3 ligation / IRAK2 mediated activation of TAK1 complex upon TLR7/8 or 9 stimulation / NOTCH2 Activation and Transmission of Signal to the Nucleus / TICAM1,TRAF6-dependent induction of TAK1 complex / TICAM1-dependent activation of IRF3/IRF7 / APC/C:Cdc20 mediated degradation of Cyclin B / cytosolic ribosome / Regulation of FZD by ubiquitination / Downregulation of ERBB4 signaling / APC-Cdc20 mediated degradation of Nek2A / p75NTR recruits signalling complexes / InlA-mediated entry of Listeria monocytogenes into host cells / TRAF6 mediated IRF7 activation in TLR7/8 or 9 signaling / TRAF6-mediated induction of TAK1 complex within TLR4 complex / Regulation of pyruvate metabolism / NF-kB is activated and signals survival / Regulation of innate immune responses to cytosolic DNA / Pexophagy / Downregulation of ERBB2:ERBB3 signaling / NRIF signals cell death from the nucleus / Activated NOTCH1 Transmits Signal to the Nucleus / Regulation of PTEN localization / VLDLR internalisation and degradation / Regulation of BACH1 activity / Synthesis of active ubiquitin: roles of E1 and E2 enzymes / MAP3K8 (TPL2)-dependent MAPK1/3 activation / ubiquitin binding / Translesion synthesis by REV1 / TICAM1, RIP1-mediated IKK complex recruitment / Translesion synthesis by POLK / InlB-mediated entry of Listeria monocytogenes into host cell / positive regulation of protein ubiquitination / Activation of IRF3, IRF7 mediated by TBK1, IKKε (IKBKE) / JNK (c-Jun kinases) phosphorylation and activation mediated by activated human TAK1 / Josephin domain DUBs / Downregulation of TGF-beta receptor signaling / positive regulation of epithelial cell proliferation / Translesion synthesis by POLI / Gap-filling DNA repair synthesis and ligation in GG-NER / IKK complex recruitment mediated by RIP1 / Regulation of activated PAK-2p34 by proteasome mediated degradation / response to gamma radiation / PINK1-PRKN Mediated Mitophagy Similarity search - Function | |||||||||
| Biological species | Homo sapiens (human)synthetic construct (others) | |||||||||
| Method | ELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 3.7 Å | |||||||||
Authors | Rennie, M.L. / Arkinson, C. / Walden, H. | |||||||||
| Funding support | United Kingdom, 2items
| |||||||||
Citation | Journal: Nat Struct Mol Biol / Year: 2021Title: Structural basis of FANCD2 deubiquitination by USP1-UAF1. Authors: Martin L Rennie / Connor Arkinson / Viduth K Chaugule / Rachel Toth / Helen Walden / ![]() Abstract: Ubiquitin-specific protease 1 (USP1) acts together with the cofactor UAF1 during DNA repair processes to specifically remove monoubiquitin signals. One substrate of the USP1-UAF1 complex is the ...Ubiquitin-specific protease 1 (USP1) acts together with the cofactor UAF1 during DNA repair processes to specifically remove monoubiquitin signals. One substrate of the USP1-UAF1 complex is the monoubiquitinated FANCI-FANCD2 heterodimer, which is involved in the repair of DNA interstrand crosslinks via the Fanconi anemia pathway. Here we determine structures of human USP1-UAF1 with and without ubiquitin and bound to monoubiquitinated FANCI-FANCD2. The crystal structures of USP1-UAF1 reveal plasticity in USP1 and key differences to USP12-UAF1 and USP46-UAF1, two related proteases. A cryo-EM reconstruction of USP1-UAF1 in complex with monoubiquitinated FANCI-FANCD2 highlights a highly orchestrated deubiquitination process, with USP1-UAF1 driving conformational changes in the substrate. An extensive interface between UAF1 and FANCI, confirmed by mutagenesis and biochemical assays, provides a molecular explanation for the requirement of both proteins, despite neither being directly involved in catalysis. Overall, our data provide molecular details of USP1-UAF1 regulation and substrate recognition. #1: Journal: Biorxiv / Year: 2020Title: Structural basis of FANCD2 deubiquitination by USP1-UAF1 Authors: Rennie, M.L. / Arkinson, C. / Chaugule, V.K. / Toth, R. / Walden, H. | |||||||||
| History |
|
-
Structure visualization
| Movie |
Movie viewer |
|---|---|
| Structure viewer | Molecule: Molmil Jmol/JSmol |
-
Downloads & links
-
Download
| PDBx/mmCIF format | 7ay1.cif.gz | 595.5 KB | Display | PDBx/mmCIF format |
|---|---|---|---|---|
| PDB format | pdb7ay1.ent.gz | 463.4 KB | Display | PDB format |
| PDBx/mmJSON format | 7ay1.json.gz | Tree view | PDBx/mmJSON format | |
| Others | Other downloads |
-Validation report
| Summary document | 7ay1_validation.pdf.gz | 1.7 MB | Display | wwPDB validaton report |
|---|---|---|---|---|
| Full document | 7ay1_full_validation.pdf.gz | 1.7 MB | Display | |
| Data in XML | 7ay1_validation.xml.gz | 92.3 KB | Display | |
| Data in CIF | 7ay1_validation.cif.gz | 139.5 KB | Display | |
| Arichive directory | https://data.pdbj.org/pub/pdb/validation_reports/ay/7ay1 ftp://data.pdbj.org/pub/pdb/validation_reports/ay/7ay1 | HTTPS FTP |
-Related structure data
| Related structure data | ![]() 11934MC ![]() 7ay0C ![]() 7ay2C M: map data used to model this data C: citing same article ( |
|---|---|
| Similar structure data |
-
Links
-
Assembly
| Deposited unit | ![]()
|
|---|---|
| 1 |
|
-
Components
-Fanconi anemia group ... , 2 types, 2 molecules AB
| #1: Protein | Mass: 150459.125 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Homo sapiens (human) / Gene: FANCI, KIAA1794 / Cell line (production host): Sf21 / Production host: ![]() |
|---|---|
| #2: Protein | Mass: 164623.828 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Homo sapiens (human) / Gene: FANCD2, FACD / Cell line (production host): Sf21 / Production host: ![]() |
-Protein , 3 types, 3 molecules CDE
| #3: Protein | Mass: 8875.125 Da / Num. of mol.: 1 / Mutation: GPGS expression tag Source method: isolated from a genetically manipulated source Source: (gene. exp.) Homo sapiens (human) / Gene: UBA52, UBCEP2 / Cell line (production host): Sf21 / Production host: ![]() |
|---|---|
| #4: Protein | Mass: 88390.273 Da / Num. of mol.: 1 / Mutation: C90S, G670A, G671A Source method: isolated from a genetically manipulated source Source: (gene. exp.) Homo sapiens (human) / Gene: USP1 / Cell line (production host): Sf21 / Production host: ![]() |
| #5: Protein | Mass: 78300.656 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Homo sapiens (human) / Gene: WDR48, KIAA1449, UAF1 / Cell line (production host): Sf21 / Production host: ![]() |
-DNA chain / Non-polymers , 2 types, 3 molecules ST

| #6: DNA chain | Mass: 5177.820 Da / Num. of mol.: 2 / Source method: obtained synthetically Details: Arbitrary DNA sequence modelled due to insufficient local resolution to determine sequence register. DNA used TGATCAGAGGTCATTTGAATTCATGGCTTCGAGCTTCATGTAGAGTCGACGGTGCTGGGAT Source: (synth.) synthetic construct (others) #7: Chemical | ChemComp-ZN / | |
|---|
-Details
| Has ligand of interest | N |
|---|---|
| Has protein modification | Y |
-Experimental details
-Experiment
| Experiment | Method: ELECTRON MICROSCOPY |
|---|---|
| EM experiment | Aggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction |
-
Sample preparation
| Component |
| ||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Molecular weight | Value: 0.49 MDa / Experimental value: NO | ||||||||||||||||||||||||
| Source (natural) |
| ||||||||||||||||||||||||
| Source (recombinant) |
| ||||||||||||||||||||||||
| Buffer solution | pH: 8 | ||||||||||||||||||||||||
| Buffer component |
| ||||||||||||||||||||||||
| Specimen | Conc.: 4.3 mg/ml / Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES | ||||||||||||||||||||||||
| Vitrification | Instrument: FEI VITROBOT MARK IV / Cryogen name: ETHANE / Humidity: 95 % / Chamber temperature: 288 K |
-
Electron microscopy imaging
| Microscopy | Model: JEOL CRYO ARM 300 |
|---|---|
| Electron gun | Electron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: FLOOD BEAM |
| Electron lens | Mode: BRIGHT FIELD |
| Image recording | Average exposure time: 14.9 sec. / Electron dose: 65 e/Å2 / Detector mode: COUNTING / Film or detector model: DIRECT ELECTRON DE-64 (8k x 8k) |
| Image scans | Movie frames/image: 59 |
-
Processing
| Software | Name: PHENIX / Version: (1.18_3855:phenix.real_space_refine) / Classification: refinement | ||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| EM software |
| ||||||||||||||||||||||||
| CTF correction | Type: PHASE FLIPPING AND AMPLITUDE CORRECTION | ||||||||||||||||||||||||
| Particle selection | Num. of particles selected: 249732 | ||||||||||||||||||||||||
| Symmetry | Point symmetry: C1 (asymmetric) | ||||||||||||||||||||||||
| 3D reconstruction | Resolution: 3.7 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 391552 / Symmetry type: POINT | ||||||||||||||||||||||||
| Refinement | Cross valid method: THROUGHOUT | ||||||||||||||||||||||||
| Displacement parameters | Biso max: 370.07 Å2 / Biso mean: 65.7212 Å2 / Biso min: 17.11 Å2 | ||||||||||||||||||||||||
| Refine LS restraints |
|
Movie
Controller
About Yorodumi



Homo sapiens (human)
United Kingdom, 2items
Citation
UCSF Chimera









PDBj





























































