[English] 日本語
![](img/lk-miru.gif)
- PDB-7ay1: Cryo-EM structure of USP1-UAF1 bound to mono-ubiquitinated FANCD2... -
+
Open data
-
Basic information
Entry | Database: PDB / ID: 7ay1 | |||||||||
---|---|---|---|---|---|---|---|---|---|---|
Title | Cryo-EM structure of USP1-UAF1 bound to mono-ubiquitinated FANCD2, and FANCI | |||||||||
![]() |
| |||||||||
![]() | HYDROLASE / deubiquitination / specificity / DNA repair / Fanconi Anemia | |||||||||
Function / homology | ![]() positive regulation of error-prone translesion synthesis / regulation of protein monoubiquitination / Signaling by cytosolic PDGFRA and PDGFRB fusion proteins / regulation of CD40 signaling pathway / regulation of regulatory T cell differentiation / monoubiquitinated protein deubiquitination / double-strand break repair involved in meiotic recombination / homologous chromosome pairing at meiosis / gamete generation / neuronal stem cell population maintenance ...positive regulation of error-prone translesion synthesis / regulation of protein monoubiquitination / Signaling by cytosolic PDGFRA and PDGFRB fusion proteins / regulation of CD40 signaling pathway / regulation of regulatory T cell differentiation / monoubiquitinated protein deubiquitination / double-strand break repair involved in meiotic recombination / homologous chromosome pairing at meiosis / gamete generation / neuronal stem cell population maintenance / brain morphogenesis / deubiquitinase activator activity / DNA repair complex / skeletal system morphogenesis / mitotic intra-S DNA damage checkpoint signaling / skin development / seminiferous tubule development / protein deubiquitination / Peptide chain elongation / Selenocysteine synthesis / Formation of a pool of free 40S subunits / Eukaryotic Translation Termination / Response of EIF2AK4 (GCN2) to amino acid deficiency / SRP-dependent cotranslational protein targeting to membrane / Viral mRNA Translation / Nonsense Mediated Decay (NMD) independent of the Exon Junction Complex (EJC) / positive regulation of double-strand break repair via homologous recombination / homeostasis of number of cells / GTP hydrolysis and joining of the 60S ribosomal subunit / L13a-mediated translational silencing of Ceruloplasmin expression / single fertilization / Major pathway of rRNA processing in the nucleolus and cytosol / embryonic organ development / Nonsense Mediated Decay (NMD) enhanced by the Exon Junction Complex (EJC) / regulation of DNA repair / interstrand cross-link repair / cytosolic ribosome / DNA polymerase binding / response to UV / condensed chromosome / Maturation of protein E / Maturation of protein E / ER Quality Control Compartment (ERQC) / Myoclonic epilepsy of Lafora / FLT3 signaling by CBL mutants / Prevention of phagosomal-lysosomal fusion / IRAK2 mediated activation of TAK1 complex / Alpha-protein kinase 1 signaling pathway / Glycogen synthesis / IRAK1 recruits IKK complex / IRAK1 recruits IKK complex upon TLR7/8 or 9 stimulation / Membrane binding and targetting of GAG proteins / Endosomal Sorting Complex Required For Transport (ESCRT) / IRAK2 mediated activation of TAK1 complex upon TLR7/8 or 9 stimulation / PTK6 Regulates RTKs and Their Effectors AKT1 and DOK1 / Negative regulation of FLT3 / Constitutive Signaling by NOTCH1 HD Domain Mutants / Regulation of FZD by ubiquitination / TICAM1,TRAF6-dependent induction of TAK1 complex / NOTCH2 Activation and Transmission of Signal to the Nucleus / TICAM1-dependent activation of IRF3/IRF7 / APC/C:Cdc20 mediated degradation of Cyclin B / p75NTR recruits signalling complexes / Downregulation of ERBB4 signaling / APC-Cdc20 mediated degradation of Nek2A / PINK1-PRKN Mediated Mitophagy / TRAF6-mediated induction of TAK1 complex within TLR4 complex / TRAF6 mediated IRF7 activation in TLR7/8 or 9 signaling / Pexophagy / Regulation of innate immune responses to cytosolic DNA / InlA-mediated entry of Listeria monocytogenes into host cells / VLDLR internalisation and degradation / Downregulation of ERBB2:ERBB3 signaling / NF-kB is activated and signals survival / NRIF signals cell death from the nucleus / Regulation of PTEN localization / Activated NOTCH1 Transmits Signal to the Nucleus / Regulation of BACH1 activity / Translesion synthesis by REV1 / Synthesis of active ubiquitin: roles of E1 and E2 enzymes / Translesion synthesis by POLK / MAP3K8 (TPL2)-dependent MAPK1/3 activation / TICAM1, RIP1-mediated IKK complex recruitment / Downregulation of TGF-beta receptor signaling / Activation of IRF3, IRF7 mediated by TBK1, IKKε (IKBKE) / Translesion synthesis by POLI / Gap-filling DNA repair synthesis and ligation in GG-NER / Josephin domain DUBs / Regulation of activated PAK-2p34 by proteasome mediated degradation / InlB-mediated entry of Listeria monocytogenes into host cell / IKK complex recruitment mediated by RIP1 / JNK (c-Jun kinases) phosphorylation and activation mediated by activated human TAK1 / TGF-beta receptor signaling in EMT (epithelial to mesenchymal transition) / N-glycan trimming in the ER and Calnexin/Calreticulin cycle / Autodegradation of Cdh1 by Cdh1:APC/C / TNFR1-induced NF-kappa-B signaling pathway / APC/C:Cdc20 mediated degradation of Securin / ubiquitin binding / positive regulation of protein ubiquitination / Asymmetric localization of PCP proteins Similarity search - Function | |||||||||
Biological species | ![]() synthetic construct (others) | |||||||||
Method | ELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 3.7 Å | |||||||||
![]() | Rennie, M.L. / Arkinson, C. / Walden, H. | |||||||||
Funding support | ![]()
| |||||||||
![]() | ![]() Title: Structural basis of FANCD2 deubiquitination by USP1-UAF1. Authors: Martin L Rennie / Connor Arkinson / Viduth K Chaugule / Rachel Toth / Helen Walden / ![]() Abstract: Ubiquitin-specific protease 1 (USP1) acts together with the cofactor UAF1 during DNA repair processes to specifically remove monoubiquitin signals. One substrate of the USP1-UAF1 complex is the ...Ubiquitin-specific protease 1 (USP1) acts together with the cofactor UAF1 during DNA repair processes to specifically remove monoubiquitin signals. One substrate of the USP1-UAF1 complex is the monoubiquitinated FANCI-FANCD2 heterodimer, which is involved in the repair of DNA interstrand crosslinks via the Fanconi anemia pathway. Here we determine structures of human USP1-UAF1 with and without ubiquitin and bound to monoubiquitinated FANCI-FANCD2. The crystal structures of USP1-UAF1 reveal plasticity in USP1 and key differences to USP12-UAF1 and USP46-UAF1, two related proteases. A cryo-EM reconstruction of USP1-UAF1 in complex with monoubiquitinated FANCI-FANCD2 highlights a highly orchestrated deubiquitination process, with USP1-UAF1 driving conformational changes in the substrate. An extensive interface between UAF1 and FANCI, confirmed by mutagenesis and biochemical assays, provides a molecular explanation for the requirement of both proteins, despite neither being directly involved in catalysis. Overall, our data provide molecular details of USP1-UAF1 regulation and substrate recognition. #1: ![]() Title: Structural basis of FANCD2 deubiquitination by USP1-UAF1 Authors: Rennie, M.L. / Arkinson, C. / Chaugule, V.K. / Toth, R. / Walden, H. | |||||||||
History |
|
-
Structure visualization
Movie |
![]() |
---|---|
Structure viewer | Molecule: ![]() ![]() |
-
Downloads & links
-
Download
PDBx/mmCIF format | ![]() | 590.7 KB | Display | ![]() |
---|---|---|---|---|
PDB format | ![]() | 463.4 KB | Display | ![]() |
PDBx/mmJSON format | ![]() | Tree view | ![]() | |
Others | ![]() |
-Validation report
Summary document | ![]() | 1.5 MB | Display | ![]() |
---|---|---|---|---|
Full document | ![]() | 1.5 MB | Display | |
Data in XML | ![]() | 92.6 KB | Display | |
Data in CIF | ![]() | 139.7 KB | Display | |
Arichive directory | ![]() ![]() | HTTPS FTP |
-Related structure data
Related structure data | ![]() 11934MC ![]() 7ay0C ![]() 7ay2C M: map data used to model this data C: citing same article ( |
---|---|
Similar structure data |
-
Links
-
Assembly
Deposited unit | ![]()
|
---|---|
1 |
|
-
Components
-Fanconi anemia group ... , 2 types, 2 molecules AB
#1: Protein | Mass: 150459.125 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() ![]() ![]() |
---|---|
#2: Protein | Mass: 164623.828 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() ![]() ![]() |
-Protein , 3 types, 3 molecules CDE
#3: Protein | Mass: 8875.125 Da / Num. of mol.: 1 / Mutation: GPGS expression tag Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() ![]() ![]() |
---|---|
#4: Protein | Mass: 88390.273 Da / Num. of mol.: 1 / Mutation: C90S, G670A, G671A Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() ![]() ![]() |
#5: Protein | Mass: 78300.656 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() ![]() ![]() |
-DNA chain / Non-polymers , 2 types, 3 molecules ST![](data/chem/img/ZN.gif)
![](data/chem/img/ZN.gif)
#6: DNA chain | Mass: 5177.820 Da / Num. of mol.: 2 / Source method: obtained synthetically Details: Arbitrary DNA sequence modelled due to insufficient local resolution to determine sequence register. DNA used TGATCAGAGGTCATTTGAATTCATGGCTTCGAGCTTCATGTAGAGTCGACGGTGCTGGGAT Source: (synth.) synthetic construct (others) #7: Chemical | ChemComp-ZN / | |
---|
-Details
Has ligand of interest | N |
---|
-Experimental details
-Experiment
Experiment | Method: ELECTRON MICROSCOPY |
---|---|
EM experiment | Aggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction |
-
Sample preparation
Component |
| ||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Molecular weight | Value: 0.49 MDa / Experimental value: NO | ||||||||||||||||||||||||
Source (natural) |
| ||||||||||||||||||||||||
Source (recombinant) |
| ||||||||||||||||||||||||
Buffer solution | pH: 8 | ||||||||||||||||||||||||
Buffer component |
| ||||||||||||||||||||||||
Specimen | Conc.: 4.3 mg/ml / Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES | ||||||||||||||||||||||||
Vitrification | Instrument: FEI VITROBOT MARK IV / Cryogen name: ETHANE / Humidity: 95 % / Chamber temperature: 288 K |
-
Electron microscopy imaging
Microscopy | Model: JEOL CRYO ARM 300 |
---|---|
Electron gun | Electron source: ![]() |
Electron lens | Mode: BRIGHT FIELD |
Image recording | Average exposure time: 14.9 sec. / Electron dose: 65 e/Å2 / Detector mode: COUNTING / Film or detector model: DIRECT ELECTRON DE-64 (8k x 8k) |
Image scans | Movie frames/image: 59 |
-
Processing
Software | Name: PHENIX / Version: (1.18_3855:phenix.real_space_refine) / Classification: refinement | ||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
EM software |
| ||||||||||||||||||||||||
CTF correction | Type: PHASE FLIPPING AND AMPLITUDE CORRECTION | ||||||||||||||||||||||||
Particle selection | Num. of particles selected: 249732 | ||||||||||||||||||||||||
Symmetry | Point symmetry: C1 (asymmetric) | ||||||||||||||||||||||||
3D reconstruction | Resolution: 3.7 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 391552 / Symmetry type: POINT | ||||||||||||||||||||||||
Refinement | Cross valid method: THROUGHOUT | ||||||||||||||||||||||||
Displacement parameters | Biso max: 370.07 Å2 / Biso mean: 65.7212 Å2 / Biso min: 17.11 Å2 | ||||||||||||||||||||||||
Refine LS restraints |
|