positive regulation of error-prone translesion synthesis / Signaling by cytosolic PDGFRA and PDGFRB fusion proteins / peptidase complex / monoubiquitinated protein deubiquitination / DNA repair complex / deubiquitinase activator activity / response to insecticide / mitotic intra-S DNA damage checkpoint signaling / negative regulation of myoblast fusion / SRC activates STAT3 in a quantitative manner, through Cadherin-11 (CDH11), RAC1 and gp130 (IL6ST) ...positive regulation of error-prone translesion synthesis / Signaling by cytosolic PDGFRA and PDGFRB fusion proteins / peptidase complex / monoubiquitinated protein deubiquitination / DNA repair complex / deubiquitinase activator activity / response to insecticide / mitotic intra-S DNA damage checkpoint signaling / negative regulation of myoblast fusion / SRC activates STAT3 in a quantitative manner, through Cadherin-11 (CDH11), RAC1 and gp130 (IL6ST) / response to UV / PELO:HBS1L and ABCE1 dissociate a ribosome on a non-stop mRNA / Peptide chain elongation / Selenocysteine synthesis / Formation of a pool of free 40S subunits / Eukaryotic Translation Termination / SRP-dependent cotranslational protein targeting to membrane / Response of EIF2AK4 (GCN2) to amino acid deficiency / protein deubiquitination / Viral mRNA Translation / Nonsense Mediated Decay (NMD) independent of the Exon Junction Complex (EJC) / GTP hydrolysis and joining of the 60S ribosomal subunit / Activation of STAT3 by cadherin engagement / L13a-mediated translational silencing of Ceruloplasmin expression / interstrand cross-link repair / positive regulation of double-strand break repair via homologous recombination / Major pathway of rRNA processing in the nucleolus and cytosol / condensed chromosome / Nonsense Mediated Decay (NMD) enhanced by the Exon Junction Complex (EJC) / DNA polymerase binding / response to gamma radiation / Maturation of protein E / Maturation of protein E / ER Quality Control Compartment (ERQC) / Myoclonic epilepsy of Lafora / regulation of DNA repair / FLT3 signaling by CBL mutants / IRAK2 mediated activation of TAK1 complex / Alpha-protein kinase 1 signaling pathway / Glycogen synthesis / IRAK1 recruits IKK complex / IRAK1 recruits IKK complex upon TLR7/8 or 9 stimulation / Prevention of phagosomal-lysosomal fusion / Endosomal Sorting Complex Required For Transport (ESCRT) / Membrane binding and targetting of GAG proteins / Regulation of TBK1, IKKε (IKBKE)-mediated activation of IRF3, IRF7 / Negative regulation of FLT3 / Regulation of TBK1, IKKε-mediated activation of IRF3, IRF7 upon TLR3 ligation / IRAK2 mediated activation of TAK1 complex upon TLR7/8 or 9 stimulation / Constitutive Signaling by NOTCH1 HD Domain Mutants / NOTCH2 Activation and Transmission of Signal to the Nucleus / TICAM1,TRAF6-dependent induction of TAK1 complex / PTK6 Regulates RTKs and Their Effectors AKT1 and DOK1 / TICAM1-dependent activation of IRF3/IRF7 / APC/C:Cdc20 mediated degradation of Cyclin B / Downregulation of ERBB4 signaling / APC-Cdc20 mediated degradation of Nek2A / positive regulation of protein ubiquitination / Regulation of FZD by ubiquitination / positive regulation of receptor signaling pathway via JAK-STAT / p75NTR recruits signalling complexes / InlA-mediated entry of Listeria monocytogenes into host cells / TRAF6 mediated IRF7 activation in TLR7/8 or 9 signaling / NF-kB is activated and signals survival / TRAF6-mediated induction of TAK1 complex within TLR4 complex / Regulation of pyruvate metabolism / Pexophagy / PD-L1(CD274) glycosylation and translocation to plasma membrane / protein modification process / NRIF signals cell death from the nucleus / Downregulation of ERBB2:ERBB3 signaling / Regulation of PTEN localization / Regulation of innate immune responses to cytosolic DNA / VLDLR internalisation and degradation / Activated NOTCH1 Transmits Signal to the Nucleus / Translesion synthesis by REV1 / Synthesis of active ubiquitin: roles of E1 and E2 enzymes / TICAM1, RIP1-mediated IKK complex recruitment / ZNF598 and the Ribosome-associated Quality Trigger (RQT) complex dissociate a ribosome stalled on a no-go mRNA / Translesion synthesis by POLK / Regulation of BACH1 activity / InlB-mediated entry of Listeria monocytogenes into host cell / JNK (c-Jun kinases) phosphorylation and activation mediated by activated human TAK1 / Activation of IRF3, IRF7 mediated by TBK1, IKKε (IKBKE) / MAP3K8 (TPL2)-dependent MAPK1/3 activation / Translesion synthesis by POLI / Downregulation of TGF-beta receptor signaling / Josephin domain DUBs / Gap-filling DNA repair synthesis and ligation in GG-NER / IKK complex recruitment mediated by RIP1 / PINK1-PRKN Mediated Mitophagy / TGF-beta receptor signaling in EMT (epithelial to mesenchymal transition) / TNFR1-induced NF-kappa-B signaling pathway / striated muscle contraction / TP53 Regulates Transcription of DNA Repair Genes / Regulation of activated PAK-2p34 by proteasome mediated degradation / TCF dependent signaling in response to WNT / Regulation of NF-kappa B signaling / activated TAK1 mediates p38 MAPK activation / Maturation of DENV proteins Similarity search - Function
Ubiquitin carboxyl-terminal hydrolase 1 / Ubiquitin-ribosomal protein eL40 fusion protein / WD repeat-containing protein 48 / Fanconi anemia group D2 protein / Fanconi anemia group I protein Similarity search - Component
Biological species
Homo sapiens (human) / synthetic construct (others)
Method
single particle reconstruction / cryo EM / Resolution: 3.7 Å
Journal: Nat Struct Mol Biol / Year: 2021 Title: Structural basis of FANCD2 deubiquitination by USP1-UAF1. Authors: Martin L Rennie / Connor Arkinson / Viduth K Chaugule / Rachel Toth / Helen Walden / Abstract: Ubiquitin-specific protease 1 (USP1) acts together with the cofactor UAF1 during DNA repair processes to specifically remove monoubiquitin signals. One substrate of the USP1-UAF1 complex is the ...Ubiquitin-specific protease 1 (USP1) acts together with the cofactor UAF1 during DNA repair processes to specifically remove monoubiquitin signals. One substrate of the USP1-UAF1 complex is the monoubiquitinated FANCI-FANCD2 heterodimer, which is involved in the repair of DNA interstrand crosslinks via the Fanconi anemia pathway. Here we determine structures of human USP1-UAF1 with and without ubiquitin and bound to monoubiquitinated FANCI-FANCD2. The crystal structures of USP1-UAF1 reveal plasticity in USP1 and key differences to USP12-UAF1 and USP46-UAF1, two related proteases. A cryo-EM reconstruction of USP1-UAF1 in complex with monoubiquitinated FANCI-FANCD2 highlights a highly orchestrated deubiquitination process, with USP1-UAF1 driving conformational changes in the substrate. An extensive interface between UAF1 and FANCI, confirmed by mutagenesis and biochemical assays, provides a molecular explanation for the requirement of both proteins, despite neither being directly involved in catalysis. Overall, our data provide molecular details of USP1-UAF1 regulation and substrate recognition.
Name: DNA (61-MER) / type: dna / ID: 6 Details: Arbitrary DNA sequence modelled due to insufficient local resolution to determine sequence register. DNA used TGATCAGAGGTCATTTGAATTCATGGCTTCGAGCTTCATGTAGAGTCGACGGTGCTGGGAT Number of copies: 2 / Classification: DNA
Name: ZINC ION / type: ligand / ID: 7 / Number of copies: 1 / Formula: ZN
Molecular weight
Theoretical: 65.409 Da
-
Experimental details
-
Structure determination
Method
cryo EM
Processing
single particle reconstruction
Aggregation state
particle
-
Sample preparation
Concentration
4.3 mg/mL
Buffer
pH: 8 Component:
Concentration
Formula
Name
20.0 mM
C4H11NO3
Tris
150.0 mM
NaCl
NaCl
2.0 mM
C4H10O2S2
DTT
Vitrification
Cryogen name: ETHANE / Chamber humidity: 95 % / Chamber temperature: 288 K / Instrument: FEI VITROBOT MARK IV
-
Electron microscopy
Microscope
JEOL CRYO ARM 300
Image recording
Film or detector model: DIRECT ELECTRON DE-64 (8k x 8k) / Detector mode: COUNTING / Average exposure time: 14.9 sec. / Average electron dose: 65.0 e/Å2
Electron beam
Acceleration voltage: 300 kV / Electron source: FIELD EMISSION GUN
Electron optics
Illumination mode: FLOOD BEAM / Imaging mode: BRIGHT FIELD
+
Image processing
Particle selection
Number selected: 249732
Startup model
Type of model: NONE / Details: Ab initio reconstruction in cryosparc
Final reconstruction
Applied symmetry - Point group: C1 (asymmetric) / Resolution.type: BY AUTHOR / Resolution: 3.7 Å / Resolution method: FSC 0.143 CUT-OFF / Software - Name: cryoSPARC (ver. 2.13.2) / Number images used: 391552
Initial angle assignment
Type: MAXIMUM LIKELIHOOD
Final angle assignment
Type: MAXIMUM LIKELIHOOD
FSC plot (resolution estimation)
+
About Yorodumi
-
News
-
Feb 9, 2022. New format data for meta-information of EMDB entries
New format data for meta-information of EMDB entries
Version 3 of the EMDB header file is now the official format.
The previous official version 1.9 will be removed from the archive.
In the structure databanks used in Yorodumi, some data are registered as the other names, "COVID-19 virus" and "2019-nCoV". Here are the details of the virus and the list of structure data.
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)
EMDB accession codes are about to change! (news from PDBe EMDB page)
The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
The EM Navigator/Yorodumi systems omit the EMD- prefix.
Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator
Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.
Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi