[English] 日本語
Yorodumi
- PDB-3wgi: Crystal structure of RSP in complex with beta-NAD+ and operator DNA -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 3wgi
TitleCrystal structure of RSP in complex with beta-NAD+ and operator DNA
Components
  • DNA (5'-D(*TP*AP*GP*AP*TP*TP*GP*TP*TP*AP*AP*TP*CP*GP*AP*TP*TP*AP*AP*CP*AP*AP*TP*C)-3')
  • Redox-sensing transcriptional repressor rex
KeywordsTRANSCRIPTION/DNA / winged helix / Rossmann fold / transcription repressor / TRANSCRIPTION-DNA complex
Function / homology
Function and homology information


response to redox state / DNA-binding transcription factor activity / nucleotide binding / negative regulation of DNA-templated transcription / DNA binding / cytoplasm
Similarity search - Function
Rex DNA-binding, C-terminal domain / Redox-sensing transcriptional repressor Rex / Putative DNA-binding protein N-terminus / CoA binding domain / CoA binding domain / CoA-binding / Winged helix-like DNA-binding domain superfamily/Winged helix DNA-binding domain / Arc Repressor Mutant, subunit A / Winged helix DNA-binding domain superfamily / NAD(P)-binding Rossmann-like Domain ...Rex DNA-binding, C-terminal domain / Redox-sensing transcriptional repressor Rex / Putative DNA-binding protein N-terminus / CoA binding domain / CoA binding domain / CoA-binding / Winged helix-like DNA-binding domain superfamily/Winged helix DNA-binding domain / Arc Repressor Mutant, subunit A / Winged helix DNA-binding domain superfamily / NAD(P)-binding Rossmann-like Domain / Winged helix-like DNA-binding domain superfamily / NAD(P)-binding domain superfamily / Rossmann fold / Orthogonal Bundle / 3-Layer(aba) Sandwich / Mainly Alpha / Alpha Beta
Similarity search - Domain/homology
NICOTINAMIDE-ADENINE-DINUCLEOTIDE (ACIDIC FORM) / DNA / DNA (> 10) / Redox-sensing transcriptional repressor Rex
Similarity search - Component
Biological speciesThermoanaerobacter ethanolicus (bacteria)
MethodX-RAY DIFFRACTION / SYNCHROTRON / MOLECULAR REPLACEMENT / Resolution: 3.25 Å
AuthorsZheng, Y. / Ko, T.-P. / Guo, R.-T.
CitationJournal: J.Struct.Biol. / Year: 2014
Title: Distinct structural features of Rex-family repressors to sense redox levels in anaerobes and aerobes.
Authors: Zheng, Y. / Ko, T.-P. / Sun, H. / Huang, C.-H. / Pei, J. / Qiu, R. / Wang, A.H.-J. / Wiegel, J. / Shao, W. / Guo, R.-T.
History
DepositionAug 5, 2013Deposition site: PDBJ / Processing site: PDBJ
Revision 1.0Aug 13, 2014Provider: repository / Type: Initial release
Revision 1.1Dec 25, 2019Group: Database references / Category: citation
Item: _citation.journal_id_ISSN / _citation.pdbx_database_id_PubMed / _citation.title

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
A: Redox-sensing transcriptional repressor rex
B: Redox-sensing transcriptional repressor rex
C: Redox-sensing transcriptional repressor rex
D: Redox-sensing transcriptional repressor rex
E: DNA (5'-D(*TP*AP*GP*AP*TP*TP*GP*TP*TP*AP*AP*TP*CP*GP*AP*TP*TP*AP*AP*CP*AP*AP*TP*C)-3')
F: DNA (5'-D(*TP*AP*GP*AP*TP*TP*GP*TP*TP*AP*AP*TP*CP*GP*AP*TP*TP*AP*AP*CP*AP*AP*TP*C)-3')
G: DNA (5'-D(*TP*AP*GP*AP*TP*TP*GP*TP*TP*AP*AP*TP*CP*GP*AP*TP*TP*AP*AP*CP*AP*AP*TP*C)-3')
H: DNA (5'-D(*TP*AP*GP*AP*TP*TP*GP*TP*TP*AP*AP*TP*CP*GP*AP*TP*TP*AP*AP*CP*AP*AP*TP*C)-3')
hetero molecules


Theoretical massNumber of molelcules
Total (without water)134,01812
Polymers131,3648
Non-polymers2,6544
Water0
1
A: Redox-sensing transcriptional repressor rex
B: Redox-sensing transcriptional repressor rex
E: DNA (5'-D(*TP*AP*GP*AP*TP*TP*GP*TP*TP*AP*AP*TP*CP*GP*AP*TP*TP*AP*AP*CP*AP*AP*TP*C)-3')
F: DNA (5'-D(*TP*AP*GP*AP*TP*TP*GP*TP*TP*AP*AP*TP*CP*GP*AP*TP*TP*AP*AP*CP*AP*AP*TP*C)-3')
hetero molecules


Theoretical massNumber of molelcules
Total (without water)67,0096
Polymers65,6824
Non-polymers1,3272
Water0
TypeNameSymmetry operationNumber
identity operation1_555x,y,z1
Buried area13890 Å2
ΔGint-88 kcal/mol
Surface area26280 Å2
MethodPISA
2
C: Redox-sensing transcriptional repressor rex
D: Redox-sensing transcriptional repressor rex
G: DNA (5'-D(*TP*AP*GP*AP*TP*TP*GP*TP*TP*AP*AP*TP*CP*GP*AP*TP*TP*AP*AP*CP*AP*AP*TP*C)-3')
H: DNA (5'-D(*TP*AP*GP*AP*TP*TP*GP*TP*TP*AP*AP*TP*CP*GP*AP*TP*TP*AP*AP*CP*AP*AP*TP*C)-3')
hetero molecules


Theoretical massNumber of molelcules
Total (without water)67,0096
Polymers65,6824
Non-polymers1,3272
Water0
TypeNameSymmetry operationNumber
identity operation1_555x,y,z1
Buried area13940 Å2
ΔGint-88 kcal/mol
Surface area26250 Å2
MethodPISA
Unit cell
Length a, b, c (Å)95.990, 116.439, 132.887
Angle α, β, γ (deg.)90.00, 90.00, 90.00
Int Tables number19
Space group name H-MP212121
Noncrystallographic symmetry (NCS)NCS domain:
IDEns-IDDetails
11A
21B
31C
41D
12E
22F
32G
42H

NCS domain segments:
Dom-IDComponent-IDEns-IDRefine codeAuth asym-IDAuth seq-ID
1111A4 - 120
2111B4 - 120
3111C4 - 120
4111D4 - 120
1211A122 - 900
2211B122 - 900
3211C122 - 900
4211D122 - 900
1121E299 - 322
2121F299 - 322
3121G299 - 322
4121H299 - 322

NCS ensembles :
ID
1
2

-
Components

#1: Protein
Redox-sensing transcriptional repressor rex / RSP repressor


Mass: 25474.279 Da / Num. of mol.: 4
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Thermoanaerobacter ethanolicus (bacteria)
Strain: JW200 / Gene: rex, rsp / Plasmid: pET28a / Production host: Escherichia coli (E. coli) / Strain (production host): BL21(DE3) / References: UniProt: D5KM69
#2: DNA chain
DNA (5'-D(*TP*AP*GP*AP*TP*TP*GP*TP*TP*AP*AP*TP*CP*GP*AP*TP*TP*AP*AP*CP*AP*AP*TP*C)-3')


Mass: 7366.802 Da / Num. of mol.: 4 / Source method: obtained synthetically / Details: operator DNA
#3: Chemical
ChemComp-NAJ / NICOTINAMIDE-ADENINE-DINUCLEOTIDE (ACIDIC FORM) / Nicotinamide adenine dinucleotide


Mass: 663.425 Da / Num. of mol.: 4 / Source method: obtained synthetically / Formula: C21H27N7O14P2
Sequence detailsSEQUENCE OF THE DNA IS AN AVERAGE OF THE REAL SEQUENCE OF TAGATTGTTAAATGAATAACAATC AND ...SEQUENCE OF THE DNA IS AN AVERAGE OF THE REAL SEQUENCE OF TAGATTGTTAAATGAATAACAATC AND TAGATTGTTATTCATTTAACAATC USED IN CRYSTALLIZATION.

-
Experimental details

-
Experiment

ExperimentMethod: X-RAY DIFFRACTION / Number of used crystals: 1

-
Sample preparation

CrystalDensity Matthews: 2.83 Å3/Da / Density % sol: 56.49 %
Crystal growTemperature: 298 K / Method: vapor diffusion, sitting drop / pH: 6
Details: 0.39mM RSP protein, 0.21mM of each DNA oligonucleotide, 1mM beta-NAD+, 0.2M sodium malonate, 20% w/v PEG3350, pH 6.0, VAPOR DIFFUSION, SITTING DROP, temperature 298K

-
Data collection

DiffractionMean temperature: 100 K
Diffraction sourceSource: SYNCHROTRON / Site: NSRRC / Beamline: BL13B1 / Wavelength: 1 Å
DetectorType: ADSC QUANTUM 315r / Detector: CCD / Date: Oct 16, 2012 / Details: mirrors
RadiationMonochromator: Si 111 / Protocol: SINGLE WAVELENGTH / Monochromatic (M) / Laue (L): M / Scattering type: x-ray
Radiation wavelengthWavelength: 1 Å / Relative weight: 1
ReflectionResolution: 3.25→25 Å / Num. all: 24010 / Num. obs: 23962 / % possible obs: 99.8 % / Observed criterion σ(F): 0 / Observed criterion σ(I): 3 / Redundancy: 3.8 % / Rmerge(I) obs: 0.072 / Net I/σ(I): 20.9
Reflection shellResolution: 3.25→3.37 Å / Redundancy: 3.8 % / Rmerge(I) obs: 0.543 / Mean I/σ(I) obs: 3 / % possible all: 100

-
Processing

Software
NameVersionClassification
Blu-IceControl Softwaredata collection
CNSrefinement
HKL-2000data reduction
HKL-2000data scaling
CNSphasing
REFMAC5.5.0109refinement
RefinementMethod to determine structure: MOLECULAR REPLACEMENT
Starting model: PDB 3WGH
Resolution: 3.25→25 Å / Cor.coef. Fo:Fc: 0.948 / Cor.coef. Fo:Fc free: 0.926 / Occupancy max: 1 / Occupancy min: 1 / SU B: 57.161 / SU ML: 0.404 / Cross valid method: THROUGHOUT / ESU R Free: 0.49 / Stereochemistry target values: MAXIMUM LIKELIHOOD / Details: HYDROGENS HAVE BEEN ADDED IN THE RIDING POSITIONS
RfactorNum. reflection% reflectionSelection details
Rfree0.22833 1105 4.9 %RANDOM
Rwork0.19337 ---
obs0.19508 22664 100 %-
Solvent computationIon probe radii: 0.8 Å / Shrinkage radii: 0.8 Å / VDW probe radii: 1.4 Å / Solvent model: MASK
Displacement parametersBiso mean: 126.468 Å2
Baniso -1Baniso -2Baniso -3
1--6.85 Å20 Å20 Å2
2--6 Å20 Å2
3---0.85 Å2
Refine analyze
FreeObs
Luzzati coordinate error0.52 Å0.38 Å
Luzzati d res low-5 Å
Luzzati sigma a0.81 Å0.61 Å
Refinement stepCycle: LAST / Resolution: 3.25→25 Å
ProteinNucleic acidLigandSolventTotal
Num. atoms6960 1956 176 0 9092
Refine LS restraints
Refine-IDTypeDev idealDev ideal targetNumber
X-RAY DIFFRACTIONr_bond_refined_d0.0140.0229452
X-RAY DIFFRACTIONr_bond_other_d
X-RAY DIFFRACTIONr_angle_refined_deg1.5832.25813196
X-RAY DIFFRACTIONr_angle_other_deg
X-RAY DIFFRACTIONr_dihedral_angle_1_deg6.6165864
X-RAY DIFFRACTIONr_dihedral_angle_2_deg44.92824.419344
X-RAY DIFFRACTIONr_dihedral_angle_3_deg21.561151324
X-RAY DIFFRACTIONr_dihedral_angle_4_deg18.7091552
X-RAY DIFFRACTIONr_chiral_restr0.0920.21492
X-RAY DIFFRACTIONr_gen_planes_refined0.0080.026368
X-RAY DIFFRACTIONr_gen_planes_other
X-RAY DIFFRACTIONr_nbd_refined
X-RAY DIFFRACTIONr_nbd_other
X-RAY DIFFRACTIONr_nbtor_refined
X-RAY DIFFRACTIONr_nbtor_other
X-RAY DIFFRACTIONr_xyhbond_nbd_refined
X-RAY DIFFRACTIONr_xyhbond_nbd_other
X-RAY DIFFRACTIONr_metal_ion_refined
X-RAY DIFFRACTIONr_metal_ion_other
X-RAY DIFFRACTIONr_symmetry_vdw_refined
X-RAY DIFFRACTIONr_symmetry_vdw_other
X-RAY DIFFRACTIONr_symmetry_hbond_refined
X-RAY DIFFRACTIONr_symmetry_hbond_other
X-RAY DIFFRACTIONr_symmetry_metal_ion_refined
X-RAY DIFFRACTIONr_symmetry_metal_ion_other
X-RAY DIFFRACTIONr_mcbond_it1.0851.54292
X-RAY DIFFRACTIONr_mcbond_other
X-RAY DIFFRACTIONr_mcangle_it2.11326936
X-RAY DIFFRACTIONr_mcangle_other
X-RAY DIFFRACTIONr_scbond_it2.11835160
X-RAY DIFFRACTIONr_scbond_other
X-RAY DIFFRACTIONr_scangle_it3.6174.56260
X-RAY DIFFRACTIONr_scangle_other
X-RAY DIFFRACTIONr_long_range_B_refined
X-RAY DIFFRACTIONr_long_range_B_other
X-RAY DIFFRACTIONr_rigid_bond_restr
X-RAY DIFFRACTIONr_sphericity_free
X-RAY DIFFRACTIONr_sphericity_bonded
Refine LS restraints NCS

Refine-ID: X-RAY DIFFRACTION

Ens-IDDom-IDAuth asym-IDNumberTypeRms dev position (Å)Weight position
11A1773tight positional0.090.05
12B1773tight positional0.10.05
13C1773tight positional0.090.05
14D1773tight positional0.090.05
21E489tight positional0.070.05
22F489tight positional0.060.05
23G489tight positional0.050.05
24H489tight positional0.050.05
11A1773tight thermal0.170.5
12B1773tight thermal0.160.5
13C1773tight thermal0.160.5
14D1773tight thermal0.150.5
21E489tight thermal0.10.5
22F489tight thermal0.110.5
23G489tight thermal0.080.5
24H489tight thermal0.080.5
LS refinement shellResolution: 3.253→3.426 Å / Total num. of bins used: 10
RfactorNum. reflection% reflection
Rfree0.343 158 -
Rwork0.309 2789 -
obs--100 %
Refinement TLS params.

Method: refined / Refine-ID: X-RAY DIFFRACTION

IDL112)L122)L132)L222)L232)L332)S11 (Å °)S12 (Å °)S13 (Å °)S21 (Å °)S22 (Å °)S23 (Å °)S31 (Å °)S32 (Å °)S33 (Å °)T112)T122)T132)T222)T232)T332)Origin x (Å)Origin y (Å)Origin z (Å)
10.97590.81320.18160.60060.388-0.0584-0.00320.06770.0934-0.13330.03690.2970.1071-0.1596-0.03370.13640.0313-0.00090.18190.0110.14566.3839-12.584314.2149
21.4619-0.22340.32610.6219-0.11150.6566-0.00680.23930.0691-0.18160.00010.05760.03390.07230.00670.18750.0343-0.00360.16860.02180.109171.3103-6.22031.1399
31.60330.17280.13030.56010.1310.6558-0.0342-0.2876-0.14180.1569-0.0218-0.3737-0.02720.11190.0560.19850.0186-0.07920.25330.03980.2718.2773-14.964924.9021
40.64230.0138-0.63250.89730.40981.34350.0317-0.127-0.0947-0.0218-0.0552-0.3844-0.1940.00020.02350.22740.0102-0.02120.1869-0.02440.294321.3716-4.677313.885
50.3683-0.15190.0327-0.0223-0.6433-1.5220.27650.11430.3316-0.11920.08880.2708-0.4039-0.0235-0.36540.31070.4034-0.11140.1096-0.16150.071565.961415.262820.851
60.3553-0.87350.1733-1.04660.27060.9529-0.09130.04320.68030.28160.15820.3237-0.4148-0.5192-0.06680.37050.2512-0.23960.0122-0.09420.256260.617516.450214.9198
72.1624-1.97130.25142.7517-0.5647-0.0002-0.0327-0.84980.19980.37220.2338-0.5091-0.70390.2456-0.20110.4797-0.0471-0.31080.4825-0.30730.145227.62347.297540.3006
85.431-2.35973.88980.106-2.31244.3194-0.0368-0.81310.54280.6909-0.0719-0.4259-0.7352-0.14760.10870.53840.0719-0.31750.3615-0.30490.224521.513411.683637.366
Refinement TLS group
IDRefine-IDRefine TLS-IDAuth asym-IDAuth seq-ID
1X-RAY DIFFRACTION1A4 - 220
2X-RAY DIFFRACTION1A900
3X-RAY DIFFRACTION2B4 - 220
4X-RAY DIFFRACTION2B900
5X-RAY DIFFRACTION3C4 - 220
6X-RAY DIFFRACTION3C900
7X-RAY DIFFRACTION4D4 - 220
8X-RAY DIFFRACTION4D900
9X-RAY DIFFRACTION5E299 - 322
10X-RAY DIFFRACTION6F299 - 322
11X-RAY DIFFRACTION7G299 - 322
12X-RAY DIFFRACTION8H299 - 322

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more