[English] 日本語
![](img/lk-miru.gif)
- PDB-3wgi: Crystal structure of RSP in complex with beta-NAD+ and operator DNA -
+
Open data
-
Basic information
Entry | Database: PDB / ID: 3wgi | ||||||
---|---|---|---|---|---|---|---|
Title | Crystal structure of RSP in complex with beta-NAD+ and operator DNA | ||||||
![]() |
| ||||||
![]() | TRANSCRIPTION/DNA / winged helix / Rossmann fold / transcription repressor / TRANSCRIPTION-DNA complex | ||||||
Function / homology | ![]() response to redox state / DNA-binding transcription factor activity / nucleotide binding / negative regulation of DNA-templated transcription / DNA binding / metal ion binding / cytoplasm Similarity search - Function | ||||||
Biological species | ![]() ![]() | ||||||
Method | ![]() ![]() ![]() | ||||||
![]() | Zheng, Y. / Ko, T.-P. / Guo, R.-T. | ||||||
![]() | ![]() Title: Distinct structural features of Rex-family repressors to sense redox levels in anaerobes and aerobes. Authors: Zheng, Y. / Ko, T.-P. / Sun, H. / Huang, C.-H. / Pei, J. / Qiu, R. / Wang, A.H.-J. / Wiegel, J. / Shao, W. / Guo, R.-T. | ||||||
History |
|
-
Structure visualization
Structure viewer | Molecule: ![]() ![]() |
---|
-
Downloads & links
-
Download
PDBx/mmCIF format | ![]() | 468 KB | Display | ![]() |
---|---|---|---|---|
PDB format | ![]() | 384.3 KB | Display | ![]() |
PDBx/mmJSON format | ![]() | Tree view | ![]() | |
Others | ![]() |
-Validation report
Summary document | ![]() | 1.6 MB | Display | ![]() |
---|---|---|---|---|
Full document | ![]() | 1.6 MB | Display | |
Data in XML | ![]() | 39.4 KB | Display | |
Data in CIF | ![]() | 51.4 KB | Display | |
Arichive directory | ![]() ![]() | HTTPS FTP |
-Related structure data
Related structure data | ![]() 3wg9C ![]() 3wghSC C: citing same article ( S: Starting model for refinement |
---|---|
Similar structure data |
-
Links
-
Assembly
Deposited unit | ![]()
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
1 | ![]()
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2 | ![]()
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Unit cell |
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Noncrystallographic symmetry (NCS) | NCS domain:
NCS domain segments: Refine code: 1
NCS ensembles :
|
-
Components
#1: Protein | Mass: 25474.279 Da / Num. of mol.: 4 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() ![]() Strain: JW200 / Gene: rex, rsp / Plasmid: pET28a / Production host: ![]() ![]() #2: DNA chain | Mass: 7366.802 Da / Num. of mol.: 4 / Source method: obtained synthetically / Details: operator DNA #3: Chemical | ChemComp-NAJ / Sequence details | SEQUENCE OF THE DNA IS AN AVERAGE OF THE REAL SEQUENCE OF TAGATTGTTAAATGAATAACAATC AND ...SEQUENCE OF THE DNA IS AN AVERAGE OF THE REAL SEQUENCE OF TAGATTGTTA | |
---|
-Experimental details
-Experiment
Experiment | Method: ![]() |
---|
-
Sample preparation
Crystal | Density Matthews: 2.83 Å3/Da / Density % sol: 56.49 % |
---|---|
Crystal grow | Temperature: 298 K / Method: vapor diffusion, sitting drop / pH: 6 Details: 0.39mM RSP protein, 0.21mM of each DNA oligonucleotide, 1mM beta-NAD+, 0.2M sodium malonate, 20% w/v PEG3350, pH 6.0, VAPOR DIFFUSION, SITTING DROP, temperature 298K |
-Data collection
Diffraction | Mean temperature: 100 K |
---|---|
Diffraction source | Source: ![]() ![]() ![]() |
Detector | Type: ADSC QUANTUM 315r / Detector: CCD / Date: Oct 16, 2012 / Details: mirrors |
Radiation | Monochromator: Si 111 / Protocol: SINGLE WAVELENGTH / Monochromatic (M) / Laue (L): M / Scattering type: x-ray |
Radiation wavelength | Wavelength: 1 Å / Relative weight: 1 |
Reflection | Resolution: 3.25→25 Å / Num. all: 24010 / Num. obs: 23962 / % possible obs: 99.8 % / Observed criterion σ(F): 0 / Observed criterion σ(I): 3 / Redundancy: 3.8 % / Rmerge(I) obs: 0.072 / Net I/σ(I): 20.9 |
Reflection shell | Resolution: 3.25→3.37 Å / Redundancy: 3.8 % / Rmerge(I) obs: 0.543 / Mean I/σ(I) obs: 3 / % possible all: 100 |
-
Processing
Software |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Refinement | Method to determine structure: ![]() Starting model: PDB 3WGH Resolution: 3.25→25 Å / Cor.coef. Fo:Fc: 0.948 / Cor.coef. Fo:Fc free: 0.926 / Occupancy max: 1 / Occupancy min: 1 / SU B: 57.161 / SU ML: 0.404 / Cross valid method: THROUGHOUT / ESU R Free: 0.49 / Stereochemistry target values: MAXIMUM LIKELIHOOD / Details: HYDROGENS HAVE BEEN ADDED IN THE RIDING POSITIONS
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Solvent computation | Ion probe radii: 0.8 Å / Shrinkage radii: 0.8 Å / VDW probe radii: 1.4 Å / Solvent model: MASK | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Displacement parameters | Biso mean: 126.468 Å2
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Refine analyze |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Refinement step | Cycle: LAST / Resolution: 3.25→25 Å
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Refine LS restraints |
|