[English] 日本語
Yorodumi- PDB-3wgi: Crystal structure of RSP in complex with beta-NAD+ and operator DNA -
+Open data
-Basic information
Entry | Database: PDB / ID: 3wgi | ||||||
---|---|---|---|---|---|---|---|
Title | Crystal structure of RSP in complex with beta-NAD+ and operator DNA | ||||||
Components |
| ||||||
Keywords | TRANSCRIPTION/DNA / winged helix / Rossmann fold / transcription repressor / TRANSCRIPTION-DNA complex | ||||||
Function / homology | Function and homology information response to redox state / DNA-binding transcription factor activity / negative regulation of DNA-templated transcription / nucleotide binding / DNA binding / metal ion binding / cytoplasm Similarity search - Function | ||||||
Biological species | Thermoanaerobacter ethanolicus (bacteria) | ||||||
Method | X-RAY DIFFRACTION / SYNCHROTRON / MOLECULAR REPLACEMENT / Resolution: 3.25 Å | ||||||
Authors | Zheng, Y. / Ko, T.-P. / Guo, R.-T. | ||||||
Citation | Journal: J.Struct.Biol. / Year: 2014 Title: Distinct structural features of Rex-family repressors to sense redox levels in anaerobes and aerobes. Authors: Zheng, Y. / Ko, T.-P. / Sun, H. / Huang, C.-H. / Pei, J. / Qiu, R. / Wang, A.H.-J. / Wiegel, J. / Shao, W. / Guo, R.-T. | ||||||
History |
|
-Structure visualization
Structure viewer | Molecule: MolmilJmol/JSmol |
---|
-Downloads & links
-Download
PDBx/mmCIF format | 3wgi.cif.gz | 468 KB | Display | PDBx/mmCIF format |
---|---|---|---|---|
PDB format | pdb3wgi.ent.gz | 384.3 KB | Display | PDB format |
PDBx/mmJSON format | 3wgi.json.gz | Tree view | PDBx/mmJSON format | |
Others | Other downloads |
-Validation report
Summary document | 3wgi_validation.pdf.gz | 1.6 MB | Display | wwPDB validaton report |
---|---|---|---|---|
Full document | 3wgi_full_validation.pdf.gz | 1.6 MB | Display | |
Data in XML | 3wgi_validation.xml.gz | 39.4 KB | Display | |
Data in CIF | 3wgi_validation.cif.gz | 51.4 KB | Display | |
Arichive directory | https://data.pdbj.org/pub/pdb/validation_reports/wg/3wgi ftp://data.pdbj.org/pub/pdb/validation_reports/wg/3wgi | HTTPS FTP |
-Related structure data
Related structure data | 3wg9C 3wghSC C: citing same article (ref.) S: Starting model for refinement |
---|---|
Similar structure data |
-Links
-Assembly
Deposited unit |
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
1 |
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2 |
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Unit cell |
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Noncrystallographic symmetry (NCS) | NCS domain:
NCS domain segments: Refine code: 1
NCS ensembles :
|
-Components
#1: Protein | Mass: 25474.279 Da / Num. of mol.: 4 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Thermoanaerobacter ethanolicus (bacteria) Strain: JW200 / Gene: rex, rsp / Plasmid: pET28a / Production host: Escherichia coli (E. coli) / Strain (production host): BL21(DE3) / References: UniProt: D5KM69 #2: DNA chain | Mass: 7366.802 Da / Num. of mol.: 4 / Source method: obtained synthetically / Details: operator DNA #3: Chemical | ChemComp-NAJ / Sequence details | SEQUENCE OF THE DNA IS AN AVERAGE OF THE REAL SEQUENCE OF TAGATTGTTAAATGAATAACAATC AND ...SEQUENCE OF THE DNA IS AN AVERAGE OF THE REAL SEQUENCE OF TAGATTGTTA | |
---|
-Experimental details
-Experiment
Experiment | Method: X-RAY DIFFRACTION / Number of used crystals: 1 |
---|
-Sample preparation
Crystal | Density Matthews: 2.83 Å3/Da / Density % sol: 56.49 % |
---|---|
Crystal grow | Temperature: 298 K / Method: vapor diffusion, sitting drop / pH: 6 Details: 0.39mM RSP protein, 0.21mM of each DNA oligonucleotide, 1mM beta-NAD+, 0.2M sodium malonate, 20% w/v PEG3350, pH 6.0, VAPOR DIFFUSION, SITTING DROP, temperature 298K |
-Data collection
Diffraction | Mean temperature: 100 K |
---|---|
Diffraction source | Source: SYNCHROTRON / Site: NSRRC / Beamline: BL13B1 / Wavelength: 1 Å |
Detector | Type: ADSC QUANTUM 315r / Detector: CCD / Date: Oct 16, 2012 / Details: mirrors |
Radiation | Monochromator: Si 111 / Protocol: SINGLE WAVELENGTH / Monochromatic (M) / Laue (L): M / Scattering type: x-ray |
Radiation wavelength | Wavelength: 1 Å / Relative weight: 1 |
Reflection | Resolution: 3.25→25 Å / Num. all: 24010 / Num. obs: 23962 / % possible obs: 99.8 % / Observed criterion σ(F): 0 / Observed criterion σ(I): 3 / Redundancy: 3.8 % / Rmerge(I) obs: 0.072 / Net I/σ(I): 20.9 |
Reflection shell | Resolution: 3.25→3.37 Å / Redundancy: 3.8 % / Rmerge(I) obs: 0.543 / Mean I/σ(I) obs: 3 / % possible all: 100 |
-Processing
Software |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Refinement | Method to determine structure: MOLECULAR REPLACEMENT Starting model: PDB 3WGH Resolution: 3.25→25 Å / Cor.coef. Fo:Fc: 0.948 / Cor.coef. Fo:Fc free: 0.926 / Occupancy max: 1 / Occupancy min: 1 / SU B: 57.161 / SU ML: 0.404 / Cross valid method: THROUGHOUT / ESU R Free: 0.49 / Stereochemistry target values: MAXIMUM LIKELIHOOD / Details: HYDROGENS HAVE BEEN ADDED IN THE RIDING POSITIONS
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Solvent computation | Ion probe radii: 0.8 Å / Shrinkage radii: 0.8 Å / VDW probe radii: 1.4 Å / Solvent model: MASK | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Displacement parameters | Biso mean: 126.468 Å2
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Refine analyze |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Refinement step | Cycle: LAST / Resolution: 3.25→25 Å
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Refine LS restraints |
|