[English] 日本語
Yorodumi
- PDB-1kx5: X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A... -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 1kx5
TitleX-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution
Components
  • DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3')
  • DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3')
  • histone H2A.1
  • histone H2B.2
  • histone H3
  • histone H4
KeywordsSTRUCTURAL PROTEIN/DNA / NUCLEOSOME / CHROMATIN / HISTONE / PROTEIN-DNA INTERACTION / NUCLEOPROTEIN / SUPERCOILED DNA / NUCLEOSOME CORE / PROTEIN-DNA COMPLEX / DNA BENDING / DNA CURVATURE / DNA-CATION BINDING / DNA-METAL BINDING / DNA SOLVATION / STRUCTURAL PROTEIN-DNA COMPLEX
Function / homology
Function and homology information


DNA-templated transcription, initiation / nucleosome / protein heterodimerization activity / DNA binding / nucleoplasm / nucleus
Similarity search - Function
Histone, subunit A / Histone, subunit A / Histone H2B signature. / Histone H2B / Histone H2B / Histone H2A conserved site / Histone H2A signature. / C-terminus of histone H2A / Histone H2A, C-terminal domain / Histone 2A ...Histone, subunit A / Histone, subunit A / Histone H2B signature. / Histone H2B / Histone H2B / Histone H2A conserved site / Histone H2A signature. / C-terminus of histone H2A / Histone H2A, C-terminal domain / Histone 2A / Histone H2A / Histone H4, conserved site / Histone H4 signature. / Histone H4 / Histone H4 / Centromere kinetochore component CENP-T histone fold / CENP-T/Histone H4, histone fold / TATA box binding protein associated factor / TATA box binding protein associated factor (TAF) / Histone H3 signature 1. / Histone H3 signature 2. / Histone H3 / Histone H3/CENP-A / Core histone H2A/H2B/H3/H4 / Histone H2A/H2B/H3 / Histone-fold / Orthogonal Bundle / Mainly Alpha
Similarity search - Domain/homology
Histone H4 / Histone H3 / Histone H2A type 1 / Histone H4 / MANGANESE (II) ION / Histone H2B 1.1 / DNA (> 100) / DNA (> 10) / DNA / Histone H3.2
Similarity search - Component
Biological speciesHomo sapiens (human)
Xenopus laevis (African clawed frog)
MethodX-RAY DIFFRACTION / SYNCHROTRON / FOURIER SYNTHESIS / Resolution: 1.94 Å
AuthorsDavey, C.A. / Sargent, D.F. / Luger, K. / Maeder, A.W. / Richmond, T.J.
Citation
Journal: J.Mol.Biol. / Year: 2002
Title: Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
Authors: Davey, C.A. / Sargent, D.F. / Luger, K. / Maeder, A.W. / Richmond, T.J.
#1: Journal: Nature / Year: 1997
Title: Crystal structure of the nucleosome core particle at 2.8 A resolution
Authors: Luger, K. / Maeder, A.W. / Richmond, R.K. / Sargent, D.F. / Richmond, T.J.
#2: Journal: Proc.Natl.Acad.Sci.USA / Year: 2002
Title: DNA-dependent divalent cation binding in the nucleosome core particle.
Authors: Davey, C.A. / Richmond, T.J.
#3: Journal: To be Published
Title: DNA structure in the nucleosome core
Authors: Richmond, T.J. / Davey, C.A.
History
DepositionJan 31, 2002Deposition site: RCSB / Processing site: RCSB
Revision 1.0Dec 25, 2002Provider: repository / Type: Initial release
Revision 1.1Apr 27, 2008Group: Version format compliance
Revision 1.2Jul 13, 2011Group: Version format compliance

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
I: DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3')
J: DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3')
A: histone H3
B: histone H4
C: histone H2A.1
D: histone H2B.2
E: histone H3
F: histone H4
G: histone H2A.1
H: histone H2B.2
hetero molecules


Theoretical massNumber of molelcules
Total (without water)200,28328
Polymers199,37210
Non-polymers91118
Water56,3873130
1


  • Idetical with deposited unit
  • defined by author
TypeNameSymmetry operationNumber
identity operation1_555x,y,z1
Unit cell
γ
α
β
Length a, b, c (Å)105.950, 181.170, 109.490
Angle α, β, γ (deg.)90.00, 90.00, 90.00
Int Tables number19
Space group name H-MP212121

-
Components

-
DNA chain , 2 types, 2 molecules IJ

#1: DNA chain DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3')


Mass: 45368.051 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Details: palindromic 147 base pair DNA duplex with exception of position 0
Source: (gene. exp.) Homo sapiens (human)
Description: DNA SEQUENCE SYNTHESIZED, CLONED, MULTIMERIZED, AND EXCISED FROM PLASMID;
Production host: Escherichia coli (E. coli)
#2: DNA chain DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3')


Mass: 45359.035 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Details: palindromic 147 base pair DNA duplex with exception of position 0
Source: (gene. exp.) Homo sapiens (human)
Description: DNA SEQUENCE SYNTHESIZED, CLONED, MULTIMERIZED, AND EXCISED FROM PLASMID
Production host: Escherichia coli (E. coli)

-
Protein , 4 types, 8 molecules AEBFCGDH

#3: Protein histone H3 /


Mass: 15303.930 Da / Num. of mol.: 2
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Xenopus laevis (African clawed frog) / Production host: Escherichia coli (E. coli) / References: UniProt: P16105, UniProt: P84233*PLUS
#4: Protein histone H4 /


Mass: 11263.231 Da / Num. of mol.: 2
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Xenopus laevis (African clawed frog) / Production host: Escherichia coli (E. coli) / References: UniProt: P02304, UniProt: P62799*PLUS
#5: Protein histone H2A.1


Mass: 13907.163 Da / Num. of mol.: 2
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Xenopus laevis (African clawed frog) / Production host: Escherichia coli (E. coli) / References: UniProt: P06897
#6: Protein histone H2B.2


Mass: 13848.097 Da / Num. of mol.: 2
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Xenopus laevis (African clawed frog) / Production host: Escherichia coli (E. coli) / References: UniProt: P02281

-
Non-polymers , 3 types, 3148 molecules

#7: Chemical
ChemComp-MN / MANGANESE (II) ION / Manganese


Mass: 54.938 Da / Num. of mol.: 14 / Source method: obtained synthetically / Formula: Mn
#8: Chemical
ChemComp-CL / CHLORIDE ION / Chloride


Mass: 35.453 Da / Num. of mol.: 4 / Source method: obtained synthetically / Formula: Cl
#9: Water ChemComp-HOH / water / Water


Mass: 18.015 Da / Num. of mol.: 3130 / Source method: isolated from a natural source / Formula: H2O

-
Experimental details

-
Experiment

ExperimentMethod: X-RAY DIFFRACTION / Number of used crystals: 44

-
Sample preparation

CrystalDensity Matthews: 2.59 Å3/Da / Density % sol: 52.54 %
Crystal growTemperature: 293 K / Method: vapor diffusion, sitting drop / pH: 6
Details: manganese chloride, potassium chloride, potassium cacodylate, pH 6.0, VAPOR DIFFUSION, SITTING DROP, temperature 293K
Components of the solutions
IDNameCrystal-IDSol-ID
1MgCl211
2KCl11
3potassium cacodylate11
Crystal grow
*PLUS
Method: vapor diffusion
Components of the solutions
*PLUS
IDConc.Common nameCrystal-IDSol-IDChemical formulaDetails
14 mg/mlprotein1drop
270-85 mM1dropMnCl2
350-60 mM1dropKCl
420 mMpotassium cacodylate1droppH6.0
540-46 mM1reservoirMnCl2
630-40 mM1reservoirKCl
710-20 mMpotassium cacodylate1reservoir

-
Data collection

DiffractionMean temperature: 103 K
Diffraction sourceSource: SYNCHROTRON / Site: ESRF / Beamline: ID14-4 / Wavelength: 0.93 Å
DetectorType: MARRESEARCH / Detector: IMAGE PLATE / Date: May 18, 1999
RadiationMonochromator: Si 111 CHANNEL / Protocol: SINGLE WAVELENGTH / Monochromatic (M) / Laue (L): M / Scattering type: x-ray
Radiation wavelengthWavelength: 0.93 Å / Relative weight: 1
ReflectionResolution: 1.94→20 Å / Num. all: 158096 / Num. obs: 151140 / % possible obs: 95.6 % / Observed criterion σ(F): 1 / Observed criterion σ(I): 1 / Redundancy: 5.1 % / Biso Wilson estimate: 35.1 Å2 / Rmerge(I) obs: 0.072
Reflection shellResolution: 1.94→2.01 Å / Rmerge(I) obs: 0.291 / % possible all: 88
Reflection
*PLUS
Lowest resolution: 20 Å
Reflection shell
*PLUS
% possible obs: 88 %

-
Processing

Software
NameClassification
DENZOdata reduction
SCALEPACKdata scaling
CNSrefinement
CNSphasing
RefinementMethod to determine structure: FOURIER SYNTHESIS
Starting model: PDB entry 1AOI
Resolution: 1.94→6 Å / Rfactor Rfree error: 0.005 / Data cutoff high absF: 2948930.38 / Data cutoff low absF: 0 / Isotropic thermal model: RESTRAINED / Cross valid method: THROUGHOUT / σ(F): 0 / Stereochemistry target values: Engh & Huber
Details: 792 OF THE PROTEIN ATOMS HAVE ZERO OCCUPANCY. THESE INCLUDE DISORDERED PORTIONS OF THE N-TERMINAL TAIL REGIONS OF CHAINS A-H AND THE C-TERMINUS OF CHAINS C & G. THE AMINO ACIDS WITH ZERO ...Details: 792 OF THE PROTEIN ATOMS HAVE ZERO OCCUPANCY. THESE INCLUDE DISORDERED PORTIONS OF THE N-TERMINAL TAIL REGIONS OF CHAINS A-H AND THE C-TERMINUS OF CHAINS C & G. THE AMINO ACIDS WITH ZERO OCCUPANCY ARE WITHIN RESIDUES 1-32 OF CHAIN A, 1-30 OF CHAIN E, 1-23 OF CHAIN B, 1-15 OF CHAIN F, 1-14 & 121-128 OF CHAIN C, 1-12 & 122-128 OF CHAIN G, 1-21 OF CHAIN D, AND 1-23 OF CHAIN H. THEY WERE INCLUDED IN THE REFINEMENT FOR STEREOCHEMICAL PURPOSES, BUT DID NOT CONTRIBUTE TO THE X-RAY TERM.
RfactorNum. reflection% reflectionSelection details
Rfree0.275 2898 2 %RANDOM
Rwork0.208 ---
all0.209 143936 --
obs0.209 143936 95.6 %-
Displacement parametersBiso mean: 51.5 Å2
Baniso -1Baniso -2Baniso -3
1-2.61 Å20 Å20 Å2
2--3.3 Å20 Å2
3----5.91 Å2
Refine analyze
FreeObs
Luzzati coordinate error0.3 Å0.23 Å
Luzzati d res low-6 Å
Luzzati sigma a0.16 Å0.18 Å
Refinement stepCycle: LAST / Resolution: 1.94→6 Å
ProteinNucleic acidLigandSolventTotal
Num. atoms7586 6021 18 3130 16755
Refine LS restraints
Refine-IDTypeDev idealDev ideal target
X-RAY DIFFRACTIONc_bond_d0.009
X-RAY DIFFRACTIONc_angle_deg1.2
X-RAY DIFFRACTIONc_dihedral_angle_d19.2
X-RAY DIFFRACTIONc_improper_angle_d1.22
X-RAY DIFFRACTIONc_mcbond_it2.121.5
X-RAY DIFFRACTIONc_mcangle_it2.842
X-RAY DIFFRACTIONc_scbond_it2.732
X-RAY DIFFRACTIONc_scangle_it3.812.5
LS refinement shellResolution: 1.94→2.06 Å / Rfactor Rfree error: 0.016 / Total num. of bins used: 6
RfactorNum. reflection% reflection
Rfree0.351 452 2.1 %
Rwork0.315 21475 -
obs--88.1 %
Xplor file
Refine-IDSerial noParam fileTopol file
X-RAY DIFFRACTION1PROTEIN_REP.PARAMPROTEIN.TOP
X-RAY DIFFRACTION2DNA-RNA_REP.PARAMDNA-RNA.TOP
X-RAY DIFFRACTION3WATER_REP.PARAMWATER.TOP
X-RAY DIFFRACTION4ION.PARAMION.TOP
Refinement
*PLUS
Lowest resolution: 6 Å
Solvent computation
*PLUS
Displacement parameters
*PLUS
Refine LS restraints
*PLUS
Refine-IDTypeDev ideal
X-RAY DIFFRACTIONc_angle_deg1.24
X-RAY DIFFRACTIONc_dihedral_angle_d
X-RAY DIFFRACTIONc_dihedral_angle_deg19.2
X-RAY DIFFRACTIONc_improper_angle_d
X-RAY DIFFRACTIONc_improper_angle_deg1.22
LS refinement shell
*PLUS
Lowest resolution: 2.01 Å / Rfactor Rfree: 0.374 / Rfactor Rwork: 0.341

+
About Yorodumi

-
News

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

-
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

+
Jun 16, 2017. Omokage search with filter

Omokage search with filter

Result of Omokage search can be filtered by keywords and the database types

Related info.:Omokage search

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more