[English] 日本語
Yorodumi
- PDB-1kx4: X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 ... -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 1kx4
TitleX-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution
Components
  • DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3')
  • histone H2A.1
  • histone H2B.2
  • histone H3
  • histone H4
KeywordsSTRUCTURAL PROTEIN/DNA / NUCLEOSOME / CHROMATIN / HISTONE / PROTEIN-DNA INTERACTION / NUCLEOPROTEIN / SUPERCOILED DNA / NUCLEOSOME CORE / PROTEIN-DNA COMPLEX / STRUCTURAL PROTEIN-DNA COMPLEX
Function / homology
Function and homology information


: / : / RNA Polymerase I Promoter Opening / RNA Polymerase I Promoter Escape / Assembly of the ORC complex at the origin of replication / Transcriptional regulation by small RNAs / chromatin organization => GO:0006325 / B-WICH complex positively regulates rRNA expression / HDACs deacetylate histones / chromatin organization => GO:0006325 ...: / : / RNA Polymerase I Promoter Opening / RNA Polymerase I Promoter Escape / Assembly of the ORC complex at the origin of replication / Transcriptional regulation by small RNAs / chromatin organization => GO:0006325 / B-WICH complex positively regulates rRNA expression / HDACs deacetylate histones / chromatin organization => GO:0006325 / Activated PKN1 stimulates transcription of AR (androgen receptor) regulated genes KLK2 and KLK3 / Chromatin modifying enzymes / Interleukin-7 signaling / HDMs demethylate histones / Senescence-Associated Secretory Phenotype (SASP) / PRC2 methylates histones and DNA / HATs acetylate histones / PKMTs methylate histone lysines / RUNX1 regulates genes involved in megakaryocyte differentiation and platelet function / RMTs methylate histone arginines / Factors involved in megakaryocyte development and platelet production / Estrogen-dependent gene expression / Oxidative Stress Induced Senescence / DNA replication-dependent chromatin assembly / nuclear chromosome / stem cell population maintenance / negative regulation of megakaryocyte differentiation / protein localization to CENP-A containing chromatin / CENP-A containing nucleosome / epigenetic regulation of gene expression / Packaging Of Telomere Ends / Recognition and association of DNA glycosylase with site containing an affected purine / Cleavage of the damaged purine / Deposition of new CENPA-containing nucleosomes at the centromere / Recognition and association of DNA glycosylase with site containing an affected pyrimidine / Cleavage of the damaged pyrimidine / Inhibition of DNA recombination at telomere / Meiotic synapsis / telomere organization / RNA Polymerase I Promoter Opening / SUMOylation of chromatin organization proteins / Assembly of the ORC complex at the origin of replication / DNA methylation / Condensation of Prophase Chromosomes / HCMV Late Events / ERCC6 (CSB) and EHMT2 (G9a) positively regulate rRNA expression / SIRT1 negatively regulates rRNA expression / PRC2 methylates histones and DNA / Defective pyroptosis / HDACs deacetylate histones / DNA-templated transcription initiation / RNA Polymerase I Promoter Escape / Nonhomologous End-Joining (NHEJ) / Transcriptional regulation by small RNAs / Formation of the beta-catenin:TCF transactivating complex / RUNX1 regulates genes involved in megakaryocyte differentiation and platelet function / Activated PKN1 stimulates transcription of AR (androgen receptor) regulated genes KLK2 and KLK3 / NoRC negatively regulates rRNA expression / G2/M DNA damage checkpoint / B-WICH complex positively regulates rRNA expression / HDMs demethylate histones / DNA Damage/Telomere Stress Induced Senescence / PKMTs methylate histone lysines / RMTs methylate histone arginines / Meiotic recombination / Pre-NOTCH Transcription and Translation / nucleosome assembly / Activation of anterior HOX genes in hindbrain development during early embryogenesis / HCMV Early Events / Transcriptional regulation of granulopoiesis / structural constituent of chromatin / nucleosome / Recruitment and ATM-mediated phosphorylation of repair and signaling proteins at DNA double strand breaks / gene expression / RUNX1 regulates transcription of genes involved in differentiation of HSCs / Processing of DNA double-strand break ends / HATs acetylate histones / Senescence-Associated Secretory Phenotype (SASP) / Oxidative Stress Induced Senescence / Estrogen-dependent gene expression / chromosome, telomeric region / Amyloid fiber formation / protein heterodimerization activity / protein domain specific binding / chromatin binding / chromatin / negative regulation of transcription by RNA polymerase II / protein-containing complex / DNA binding / RNA binding / extracellular exosome / extracellular region / nucleoplasm / membrane / nucleus
Similarity search - Function
Histone, subunit A / Histone, subunit A / Histone H2B signature. / Histone H2B / Histone H2B / Histone H2A conserved site / Histone H2A signature. / Histone H2A, C-terminal domain / C-terminus of histone H2A / Histone H2A ...Histone, subunit A / Histone, subunit A / Histone H2B signature. / Histone H2B / Histone H2B / Histone H2A conserved site / Histone H2A signature. / Histone H2A, C-terminal domain / C-terminus of histone H2A / Histone H2A / Histone 2A / Histone H4, conserved site / Histone H4 signature. / Histone H4 / Histone H4 / CENP-T/Histone H4, histone fold / Centromere kinetochore component CENP-T histone fold / TATA box binding protein associated factor / TATA box binding protein associated factor (TAF), histone-like fold domain / Histone H3 signature 1. / Histone H3 signature 2. / Histone H3 / Histone H3/CENP-A / Histone H2A/H2B/H3 / Core histone H2A/H2B/H3/H4 / Histone-fold / Orthogonal Bundle / Mainly Alpha
Similarity search - Domain/homology
: / DNA / DNA (> 10) / DNA (> 100) / Histone H2B 1.1 / Histone H4 / Histone H2A type 1 / Histone H3.2 / Histone H4 / Histone H3.2
Similarity search - Component
Biological speciesHomo sapiens (human)
Xenopus laevis (African clawed frog)
MethodX-RAY DIFFRACTION / SYNCHROTRON / MOLECULAR REPLACEMENT / Resolution: 2.6 Å
AuthorsDavey, C.A. / Sargent, D.F. / Luger, K. / Maeder, A.W. / Richmond, T.J.
Citation
Journal: J.Mol.Biol. / Year: 2002
Title: Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
Authors: Davey, C.A. / Sargent, D.F. / Luger, K. / Maeder, A.W. / Richmond, T.J.
#1: Journal: Nature / Year: 1997
Title: Crystal structure of the nucleosome core particle at 2.8 A resolution
Authors: Luger, K. / Maeder, A.W. / Richmond, R.K. / Sargent, D.F. / Richmond, T.J.
History
DepositionJan 31, 2002Deposition site: RCSB / Processing site: RCSB
Revision 1.0Dec 25, 2002Provider: repository / Type: Initial release
Revision 1.1Apr 27, 2008Group: Version format compliance
Revision 1.2Jul 13, 2011Group: Version format compliance
Revision 1.3Aug 16, 2023Group: Data collection / Database references ...Data collection / Database references / Derived calculations / Refinement description
Category: chem_comp_atom / chem_comp_bond ...chem_comp_atom / chem_comp_bond / database_2 / pdbx_initial_refinement_model / pdbx_struct_conn_angle / struct_conn / struct_ref_seq_dif / struct_site
Item: _database_2.pdbx_DOI / _database_2.pdbx_database_accession ..._database_2.pdbx_DOI / _database_2.pdbx_database_accession / _pdbx_struct_conn_angle.ptnr1_auth_seq_id / _pdbx_struct_conn_angle.ptnr3_auth_seq_id / _pdbx_struct_conn_angle.value / _struct_conn.pdbx_dist_value / _struct_conn.ptnr1_auth_asym_id / _struct_conn.ptnr1_auth_comp_id / _struct_conn.ptnr1_auth_seq_id / _struct_conn.ptnr1_label_asym_id / _struct_conn.ptnr1_label_atom_id / _struct_conn.ptnr1_label_comp_id / _struct_conn.ptnr1_label_seq_id / _struct_conn.ptnr2_auth_asym_id / _struct_conn.ptnr2_auth_comp_id / _struct_conn.ptnr2_auth_seq_id / _struct_conn.ptnr2_label_asym_id / _struct_conn.ptnr2_label_atom_id / _struct_conn.ptnr2_label_comp_id / _struct_conn.ptnr2_label_seq_id / _struct_conn.ptnr2_symmetry / _struct_ref_seq_dif.details / _struct_site.pdbx_auth_asym_id / _struct_site.pdbx_auth_comp_id / _struct_site.pdbx_auth_seq_id

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
I: DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3')
J: DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3')
A: histone H3
B: histone H4
C: histone H2A.1
D: histone H2B.2
E: histone H3
F: histone H4
G: histone H2A.1
H: histone H2B.2
hetero molecules


Theoretical massNumber of molelcules
Total (without water)199,22620
Polymers198,75510
Non-polymers47110
Water7,800433
1


  • Idetical with deposited unit
  • defined by author
TypeNameSymmetry operationNumber
identity operation1_555x,y,z1
Unit cell
Length a, b, c (Å)105.300, 175.690, 109.530
Angle α, β, γ (deg.)90.00, 90.00, 90.00
Int Tables number19
Space group name H-MP212121

-
Components

-
DNA chain , 1 types, 2 molecules IJ

#1: DNA chain DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3')


Mass: 45054.840 Da / Num. of mol.: 2
Source method: isolated from a genetically manipulated source
Details: palindromic 146 base pair DNA duplex / Source: (gene. exp.) Homo sapiens (human)
Description: DNA SEQUENCE SYNTHESIZED, CLONED, MULTIMERIZED, AND EXCISED FROM PLASMID
Production host: Escherichia coli (E. coli)

-
Protein , 4 types, 8 molecules AEBFCGDH

#2: Protein histone H3 /


Mass: 15303.930 Da / Num. of mol.: 2
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Xenopus laevis (African clawed frog) / Production host: Escherichia coli (E. coli) / References: UniProt: P16105, UniProt: P84233*PLUS
#3: Protein histone H4 /


Mass: 11263.231 Da / Num. of mol.: 2
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Xenopus laevis (African clawed frog) / Production host: Escherichia coli (E. coli) / References: UniProt: P02304, UniProt: P62799*PLUS
#4: Protein histone H2A.1


Mass: 13907.163 Da / Num. of mol.: 2
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Xenopus laevis (African clawed frog) / Production host: Escherichia coli (E. coli) / References: UniProt: P06897
#5: Protein histone H2B.2


Mass: 13848.097 Da / Num. of mol.: 2
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Xenopus laevis (African clawed frog) / Production host: Escherichia coli (E. coli) / References: UniProt: P02281

-
Non-polymers , 3 types, 443 molecules

#6: Chemical
ChemComp-MN / MANGANESE (II) ION


Mass: 54.938 Da / Num. of mol.: 6 / Source method: obtained synthetically / Formula: Mn
#7: Chemical
ChemComp-CL / CHLORIDE ION / Chloride


Mass: 35.453 Da / Num. of mol.: 4 / Source method: obtained synthetically / Formula: Cl
#8: Water ChemComp-HOH / water / Water


Mass: 18.015 Da / Num. of mol.: 433 / Source method: isolated from a natural source / Formula: H2O

-
Experimental details

-
Experiment

ExperimentMethod: X-RAY DIFFRACTION / Number of used crystals: 5

-
Sample preparation

CrystalDensity Matthews: 2.51 Å3/Da / Density % sol: 50.93 %
Crystal growTemperature: 293 K / Method: vapor diffusion, sitting drop / pH: 6
Details: manganese chloride, potassium chloride, potassium cacodylate, pH 6.0, VAPOR DIFFUSION, SITTING DROP, temperature 293K
Components of the solutions
IDNameCrystal-IDSol-ID
1MGCl211
2KCl11
3potassium cacodylate11
Crystal grow
*PLUS
Method: vapor diffusion
Components of the solutions
*PLUS
IDConc.Common nameCrystal-IDSol-IDChemical formulaDetails
14 mg/mlprotein1drop
270-85 mM1dropMnCl2
350-60 mM1dropKCl
420 mMpotassium cacodylate1droppH6.0
540-46 mM1reservoirMnCl2
630-40 mM1reservoirKCl
710-20 mMpotassium cacodylate1reservoir

-
Data collection

DiffractionMean temperature: 103 K
Diffraction sourceSource: SYNCHROTRON / Site: ESRF / Beamline: ID09 / Wavelength: 0.85 Å
DetectorType: MARRESEARCH / Detector: IMAGE PLATE / Date: Jun 2, 1996
RadiationMonochromator: Si 111 CHANNEL / Protocol: SINGLE WAVELENGTH / Monochromatic (M) / Laue (L): M / Scattering type: x-ray
Radiation wavelengthWavelength: 0.85 Å / Relative weight: 1
ReflectionResolution: 2.6→30 Å / Num. all: 67577 / Num. obs: 60481 / % possible obs: 89.5 % / Observed criterion σ(F): 1 / Observed criterion σ(I): 1 / Redundancy: 3.7 % / Biso Wilson estimate: 54.8 Å2 / Rmerge(I) obs: 0.072
Reflection shellResolution: 2.6→2.69 Å / Rmerge(I) obs: 0.157 / % possible all: 45.7
Reflection
*PLUS
Lowest resolution: 30 Å
Reflection shell
*PLUS
% possible obs: 45.7 %

-
Processing

Software
NameClassification
DENZOdata reduction
SCALEPACKdata scaling
CNSrefinement
CNSphasing
RefinementMethod to determine structure: MOLECULAR REPLACEMENT
Starting model: PDB entry 1AOI
Resolution: 2.6→6 Å / Rfactor Rfree error: 0.009 / Data cutoff high absF: 2275168.46 / Data cutoff low absF: 0 / Isotropic thermal model: RESTRAINED / Cross valid method: THROUGHOUT / σ(F): 0 / Stereochemistry target values: Engh & Huber
RfactorNum. reflection% reflectionSelection details
Rfree0.3 1043 2 %RANDOM
Rwork0.246 ---
all0.247 52906 --
obs0.247 52906 91.6 %-
Displacement parametersBiso mean: 51.6 Å2
Baniso -1Baniso -2Baniso -3
1-5.75 Å20 Å20 Å2
2--6.4 Å20 Å2
3----12.15 Å2
Refine analyze
FreeObs
Luzzati coordinate error0.44 Å0.35 Å
Luzzati d res low-6 Å
Luzzati sigma a0.2 Å0.12 Å
Refinement stepCycle: LAST / Resolution: 2.6→6 Å
ProteinNucleic acidLigandSolventTotal
Num. atoms6015 5980 10 433 12438
Refine LS restraints
Refine-IDTypeDev idealDev ideal target
X-RAY DIFFRACTIONc_bond_d0.006
X-RAY DIFFRACTIONc_angle_deg1
X-RAY DIFFRACTIONc_dihedral_angle_d18.5
X-RAY DIFFRACTIONc_improper_angle_d1
X-RAY DIFFRACTIONc_mcbond_it1.591.5
X-RAY DIFFRACTIONc_mcangle_it2.582
X-RAY DIFFRACTIONc_scbond_it2.072
X-RAY DIFFRACTIONc_scangle_it3.032.5
LS refinement shellResolution: 2.6→2.75 Å / Rfactor Rfree error: 0.032 / Total num. of bins used: 6
RfactorNum. reflection% reflection
Rfree0.374 134 1.8 %
Rwork0.326 7486 -
obs--79.9 %
Xplor file
Refine-IDSerial noParam fileTopol file
X-RAY DIFFRACTION1PROTEIN_REP.PARAMPROTEIN.TOP
X-RAY DIFFRACTION2DNA-RNA_REP.PARAMDNA-RNA.TOP
X-RAY DIFFRACTION3WATER_REP.PARAMWATER.TOP
X-RAY DIFFRACTION4ION.PARAMION.TOP
Refinement
*PLUS
Highest resolution: 2.6 Å / Lowest resolution: 6 Å / Rfactor Rfree: 0.3
Solvent computation
*PLUS
Displacement parameters
*PLUS
Refine LS restraints
*PLUS
Refine-IDTypeDev ideal
X-RAY DIFFRACTIONc_angle_deg0.96
X-RAY DIFFRACTIONc_dihedral_angle_d
X-RAY DIFFRACTIONc_dihedral_angle_deg18.5
X-RAY DIFFRACTIONc_improper_angle_d
X-RAY DIFFRACTIONc_improper_angle_deg1
LS refinement shell
*PLUS
Lowest resolution: 2.68 Å / Rfactor Rfree: 0.361 / Rfactor Rwork: 0.329

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more