[English] 日本語
Yorodumi
- EMDB-5127: Three-dimensional EM structure of an intact activator-dependent t... -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: EMDB / ID: EMD-5127
TitleThree-dimensional EM structure of an intact activator-dependent transcription initiation complex
Map dataE. coli Class I transcription activation complex
Sample
  • Sample: E. coli RNA polymerase holoenzyme (sigma70) and E. coli catabolite activator protein (CAP) bound to 98-mer DNA containing the lac promoter and engineered open transcription bubble
  • Protein or peptide: Catabolite Activator Protein
  • Protein or peptide: RNA polymerase holoenzyme (sigma70)
  • DNA: lac(ICAP)UP-UV5-bubble
Keywordstranscription / initiation / Class I / activator / RNA polymerase / holoenzyme / sigma70 / open complex / CAP / CRP / cAMP-dependent / DNA / prokaryotic
Function / homology
Function and homology information


carbon catabolite repression of transcription / sigma factor antagonist complex / DNA binding, bending / RNA polymerase complex / submerged biofilm formation / cellular response to cell envelope stress / minor groove of adenine-thymine-rich DNA binding / regulation of DNA-templated transcription initiation / sigma factor activity / bacterial-type flagellum assembly ...carbon catabolite repression of transcription / sigma factor antagonist complex / DNA binding, bending / RNA polymerase complex / submerged biofilm formation / cellular response to cell envelope stress / minor groove of adenine-thymine-rich DNA binding / regulation of DNA-templated transcription initiation / sigma factor activity / bacterial-type flagellum assembly / bacterial-type RNA polymerase core enzyme binding / cytosolic DNA-directed RNA polymerase complex / bacterial-type flagellum-dependent cell motility / nitrate assimilation / cAMP binding / regulation of DNA-templated transcription elongation / transcription elongation factor complex / DNA-directed RNA polymerase complex / cell motility / transcription antitermination / DNA-templated transcription initiation / protein-DNA complex / ribonucleoside binding / DNA-directed RNA polymerase / DNA-directed RNA polymerase activity / response to heat / protein-containing complex assembly / sequence-specific DNA binding / intracellular iron ion homeostasis / protein dimerization activity / transcription cis-regulatory region binding / DNA-binding transcription factor activity / response to antibiotic / negative regulation of DNA-templated transcription / regulation of DNA-templated transcription / positive regulation of DNA-templated transcription / magnesium ion binding / DNA-templated transcription / DNA binding / zinc ion binding / membrane / identical protein binding / cytosol / cytoplasm
Similarity search - Function
: / Transcription regulator HTH, Crp-type, conserved site / Crp-type HTH domain signature. / helix_turn_helix, cAMP Regulatory protein / : / Crp-like helix-turn-helix domain / Crp-type HTH domain profile. / Crp-type HTH domain / RNA polymerase sigma factor 70, non-essential domain / Sigma-70, non-essential region ...: / Transcription regulator HTH, Crp-type, conserved site / Crp-type HTH domain signature. / helix_turn_helix, cAMP Regulatory protein / : / Crp-like helix-turn-helix domain / Crp-type HTH domain profile. / Crp-type HTH domain / RNA polymerase sigma factor 70, non-essential domain / Sigma-70, non-essential region / RNA polymerase sigma factor 70, region 1.1 / Sigma-70 factor, region 1.1 superfamily / Sigma-70 factor, region 1.1 / Cyclic nucleotide-binding domain signature 2. / Cyclic nucleotide-binding domain signature 1. / Cyclic nucleotide-binding, conserved site / Sigma-70 factors family signature 1. / RNA polymerase sigma factor RpoD, C-terminal / RNA polymerase sigma factor RpoD / : / RNA polymerase sigma-70 region 1.2 / Sigma-70 factor, region 1.2 / RNA polymerase sigma-70 region 3 / Sigma-70 region 3 / Sigma-70 factors family signature 2. / RNA polymerase sigma-70 / RNA polymerase sigma-70 region 4 / Sigma-70, region 4 / RNA polymerase sigma-70 region 2 / RNA polymerase sigma-70 like domain / Sigma-70 region 2 / RNA polymerase sigma factor, region 2 / RNA polymerase sigma factor, region 3/4-like / Cyclic nucleotide-monophosphate binding domain / Cyclic nucleotide-binding domain / cAMP/cGMP binding motif profile. / Cyclic nucleotide-binding domain / Cyclic nucleotide-binding domain superfamily / DNA-directed RNA polymerase, omega subunit / DNA-directed RNA polymerase, subunit beta-prime, bacterial type / DNA-directed RNA polymerase, beta subunit, external 1 domain superfamily / DNA-directed RNA polymerase, beta subunit, external 1 domain / RNA polymerase beta subunit external 1 domain / RNA polymerase, alpha subunit, C-terminal / Bacterial RNA polymerase, alpha chain C terminal domain / DNA-directed RNA polymerase beta subunit, bacterial-type / DNA-directed RNA polymerase, alpha subunit / RmlC-like jelly roll fold / DNA-directed RNA polymerase, subunit beta-prime / RNA polymerase Rpb6 / RNA polymerase Rpb2, domain 2 superfamily / RNA polymerase, subunit omega/Rpo6/RPB6 / RNA polymerase Rpb6 / RNA polymerase Rpb1, domain 3 superfamily / RPB6/omega subunit-like superfamily / RNA polymerase Rpb1, clamp domain superfamily / RNA polymerase Rpb1, domain 3 / RNA polymerase Rpb1, domain 3 / RNA polymerase Rpb1, domain 1 / RNA polymerase Rpb1, domain 1 / RNA polymerase, beta subunit, protrusion / RNA polymerase beta subunit / DNA-directed RNA polymerase, insert domain / DNA-directed RNA polymerase, RpoA/D/Rpb3-type / RNA polymerase Rpb3/RpoA insert domain / RNA polymerase Rpb3/Rpb11 dimerisation domain / RNA polymerases D / RNA polymerase, alpha subunit / RNA polymerase Rpb1, domain 5 / RNA polymerase Rpb1, domain 4 / RNA polymerase Rpb1, domain 2 / RNA polymerase Rpb1, domain 5 / RNA polymerase Rpb1, domain 4 / RNA polymerase Rpb2, domain 2 / RNA polymerase Rpb2, domain 2 / RNA polymerase, N-terminal / RNA polymerase Rpb1, funnel domain superfamily / RNA polymerase I subunit A N-terminus / DNA-directed RNA polymerase, insert domain superfamily / RNA polymerase, RBP11-like subunit / RNA polymerase, beta subunit, conserved site / RNA polymerase Rpb2, domain 7 / RNA polymerase Rpb2, domain 3 / RNA polymerase Rpb2, OB-fold / RNA polymerase Rpb2, domain 7 / RNA polymerase Rpb2, domain 3 / RNA polymerases beta chain signature. / DNA-directed RNA polymerase, subunit 2, hybrid-binding domain / DNA-directed RNA polymerase, subunit 2 / DNA-directed RNA polymerase, subunit 2, hybrid-binding domain superfamily / RNA polymerase Rpb2, domain 6 / Winged helix DNA-binding domain superfamily / Winged helix-like DNA-binding domain superfamily
Similarity search - Domain/homology
RNA polymerase sigma factor RpoD / DNA-directed RNA polymerase subunit alpha / DNA-directed RNA polymerase subunit omega / DNA-directed RNA polymerase subunit beta' / DNA-directed RNA polymerase subunit beta / DNA-binding transcriptional dual regulator CRP
Similarity search - Component
Biological speciesEscherichia coli (E. coli) / unidentified (others)
Methodsingle particle reconstruction / negative staining / Resolution: 19.8 Å
AuthorsHudson BP / Quispe J / Lara S / Kim Y / Berman HM / Arnold E / Ebright RH / Lawson CL
CitationJournal: Proc Natl Acad Sci U S A / Year: 2009
Title: Three-dimensional EM structure of an intact activator-dependent transcription initiation complex.
Authors: Brian P Hudson / Joel Quispe / Samuel Lara-González / Younggyu Kim / Helen M Berman / Eddy Arnold / Richard H Ebright / Catherine L Lawson /
Abstract: We present the experimentally determined 3D structure of an intact activator-dependent transcription initiation complex comprising the Escherichia coli catabolite activator protein (CAP), RNA ...We present the experimentally determined 3D structure of an intact activator-dependent transcription initiation complex comprising the Escherichia coli catabolite activator protein (CAP), RNA polymerase holoenzyme (RNAP), and a DNA fragment containing positions -78 to +20 of a Class I CAP-dependent promoter with a CAP site at position -61.5 and a premelted transcription bubble. A 20-A electron microscopy reconstruction was obtained by iterative projection-based matching of single particles visualized in carbon-sandwich negative stain and was fitted using atomic coordinate sets for CAP, RNAP, and DNA. The structure defines the organization of a Class I CAP-RNAP-promoter complex and supports previously proposed interactions of CAP with RNAP alpha subunit C-terminal domain (alphaCTD), interactions of alphaCTD with sigma(70) region 4, interactions of CAP and RNAP with promoter DNA, and phased-DNA-bend-dependent partial wrapping of DNA around the complex. The structure also reveals the positions and shapes of species-specific domains within the RNAP beta', beta, and sigma(70) subunits.
History
DepositionJul 30, 2009-
Header (metadata) releaseAug 24, 2009-
Map releaseNov 4, 2009-
UpdateMay 21, 2012-
Current statusMay 21, 2012Processing site: RCSB / Status: Released

-
Structure visualization

Movie
  • Surface view with section colored by density value
  • Surface level: 2.8
  • Imaged by UCSF Chimera
  • Download
  • Surface view colored by radius
  • Surface level: 2.8
  • Imaged by UCSF Chimera
  • Download
  • Surface view with fitted model
  • Atomic models: PDB-3iyd
  • Surface level: 2.8
  • Imaged by UCSF Chimera
  • Download
Movie viewer
Structure viewerEM map:
SurfViewMolmilJmol/JSmol
Supplemental images

Downloads & links

-
Map

FileDownload / File: emd_5127.map.gz / Format: CCP4 / Size: 1.9 MB / Type: IMAGE STORED AS FLOATING POINT NUMBER (4 BYTES)
AnnotationE. coli Class I transcription activation complex
Projections & slices

Image control

Size
Brightness
Contrast
Others
AxesZ (Sec.)Y (Row.)X (Col.)
4.64 Å/pix.
x 80 pix.
= 371.2 Å
4.64 Å/pix.
x 80 pix.
= 371.2 Å
4.64 Å/pix.
x 80 pix.
= 371.2 Å

Surface

Projections

Slices (1/3)

Slices (1/2)

Slices (2/3)

Images are generated by Spider.

Voxel sizeX=Y=Z: 4.64 Å
Density
Contour LevelBy AUTHOR: 2.8 / Movie #1: 2.8
Minimum - Maximum-3.34078479 - 14.395241739999999
Average (Standard dev.)0.0 (±0.90271008)
SymmetrySpace group: 1
Details

EMDB XML:

Map geometry
Axis orderXYZ
Origin-40-40-40
Dimensions808080
Spacing808080
CellA=B=C: 371.19998 Å
α=β=γ: 90.0 °

CCP4 map header:

modeImage stored as Reals
Å/pix. X/Y/Z4.644.644.64
M x/y/z808080
origin x/y/z0.0000.0000.000
length x/y/z371.200371.200371.200
α/β/γ90.00090.00090.000
start NX/NY/NZ-34-26-72
NX/NY/NZ6953145
MAP C/R/S123
start NC/NR/NS-40-40-40
NC/NR/NS808080
D min/max/mean-3.34114.395-0.000

-
Supplemental data

-
Sample components

-
Entire : E. coli RNA polymerase holoenzyme (sigma70) and E. coli catabolit...

EntireName: E. coli RNA polymerase holoenzyme (sigma70) and E. coli catabolite activator protein (CAP) bound to 98-mer DNA containing the lac promoter and engineered open transcription bubble
Components
  • Sample: E. coli RNA polymerase holoenzyme (sigma70) and E. coli catabolite activator protein (CAP) bound to 98-mer DNA containing the lac promoter and engineered open transcription bubble
  • Protein or peptide: Catabolite Activator Protein
  • Protein or peptide: RNA polymerase holoenzyme (sigma70)
  • DNA: lac(ICAP)UP-UV5-bubble

-
Supramolecule #1000: E. coli RNA polymerase holoenzyme (sigma70) and E. coli catabolit...

SupramoleculeName: E. coli RNA polymerase holoenzyme (sigma70) and E. coli catabolite activator protein (CAP) bound to 98-mer DNA containing the lac promoter and engineered open transcription bubble
type: sample / ID: 1000 / Details: Complex formation was verified by gel shift
Oligomeric state: One molecule of RNAP (containing six subunits) and one CAP homodimer bound to a DNA duplex)
Number unique components: 3
Molecular weightTheoretical: 570 KDa

-
Macromolecule #1: Catabolite Activator Protein

MacromoleculeName: Catabolite Activator Protein / type: protein_or_peptide / ID: 1 / Name.synonym: CAP / Number of copies: 1 / Oligomeric state: homodimer / Recombinant expression: Yes
Source (natural)Organism: Escherichia coli (E. coli) / Strain: K12
Molecular weightTheoretical: 50 KDa
Recombinant expressionOrganism: Escherichia coli BL21(DE3) (bacteria) / Recombinant plasmid: pET21(a)
SequenceGO: regulation of DNA-templated transcription / InterPro: INTERPRO: IPR001808

-
Macromolecule #3: RNA polymerase holoenzyme (sigma70)

MacromoleculeName: RNA polymerase holoenzyme (sigma70) / type: protein_or_peptide / ID: 3 / Name.synonym: RNAP
Details: Six subunits include alphaI (RpoA), alphaII (RpoA), beta (RpoB), beta prime (RpoC) with C-terminal 6His-tag, omega (RpoZ), and sigma70.
Number of copies: 1 / Oligomeric state: heterohexamer / Recombinant expression: Yes
Source (natural)Organism: Escherichia coli (E. coli) / Strain: K12 / synonym: Escherichia coli
Molecular weightTheoretical: 460 KDa
Recombinant expressionOrganism: Escherichia coli BL21(DE3) (bacteria) / Recombinant plasmid: pEcABC-H6, pRSFduet-sigma, pCDF-omega
SequenceGO: DNA-templated transcription

-
Macromolecule #2: lac(ICAP)UP-UV5-bubble

MacromoleculeName: lac(ICAP)UP-UV5-bubble / type: dna / ID: 2 / Name.synonym: lac(ICAP)UP-UV5-bubble
Details: An engineered 98mer duplex based on positions -78 to 20 of the Class I CAP-dependent promoter lac but containing consensus -10 sequence and consensus binding sites for CAP and RNAP alpha-CTD. ...Details: An engineered 98mer duplex based on positions -78 to 20 of the Class I CAP-dependent promoter lac but containing consensus -10 sequence and consensus binding sites for CAP and RNAP alpha-CTD. Positions -11 to 2 are non-complementary to create an artificial transcription bubble. Top strand 5'-CGCAATAAATGTGATCTAGATCACATTTTAGGCAAAAAAGGCTTTACACTTTATGCTTCCGGCTCGTATAATCGCACCTTATGTGAGCGGATAACAAG-3' Bottom strand 5'-CTTGTTATCCGCTCACAATTCCACACTAATAACGAGCCGGAAGCATAAAGTGTAAAGCCTTTTTTGCCTAAAATGTGATCTAGATCACATTTATTGCG-3'
Classification: DNA / Structure: OTHER / Synthetic?: Yes
Source (natural)Organism: unidentified (others)
Molecular weightExperimental: 60 KDa / Theoretical: 60 KDa

-
Experimental details

-
Structure determination

Methodnegative staining
Processingsingle particle reconstruction
Aggregation stateparticle

-
Sample preparation

Concentration6.18 mg/mL
BufferpH: 8
Details: 25mM HEPES, 100mM KCl, 10mM MgCl2, 1mM DTT, 0.2mM cAMP
StainingType: NEGATIVE
Details: Sample and 2% uranyl formate stain were applied to the grid in rapid succession, with the last drop of stain remaining on the sample for 1 minute. The grid was then submerged in stain and ...Details: Sample and 2% uranyl formate stain were applied to the grid in rapid succession, with the last drop of stain remaining on the sample for 1 minute. The grid was then submerged in stain and brought up under thin carbon to form an upper sandwich layer. The grid was then blotted and dried for 10 minutes.
GridDetails: 400-mesh copper 2.0x0.5 hole pattern C-flat grid covered with thin layer of continuous carbon
VitrificationCryogen name: NONE / Instrument: OTHER

-
Electron microscopy

MicroscopeFEI TECNAI F20
TemperatureAverage: 293 K
Details15 um pixel size on detector
DateNov 4, 2008
Image recordingCategory: CCD / Film or detector model: TVIPS TEMCAM-F415 (4k x 4k) / Number real images: 349 / Average electron dose: 16 e/Å2
Electron beamAcceleration voltage: 120 kV / Electron source: FIELD EMISSION GUN
Electron opticsIllumination mode: FLOOD BEAM / Imaging mode: BRIGHT FIELD / Cs: 2.0 mm / Nominal defocus max: 1.5 µm / Nominal defocus min: 0.5 µm / Nominal magnification: 50000
Sample stageSpecimen holder: standard side-entry room-temperature stage / Specimen holder model: SIDE ENTRY, EUCENTRIC
Experimental equipment
Model: Tecnai F20 / Image courtesy: FEI Company

-
Image processing

Details32816 particles were automatically selected by the Appion DoGpicker initially
CTF correctionDetails: ACE
Final reconstructionAlgorithm: OTHER / Resolution.type: BY AUTHOR / Resolution: 19.8 Å / Resolution method: FSC 0.5 CUT-OFF / Software - Name: EMAN, SPIDER
Details: EMAN interleaved with SPIDER correspondence analysis
Number images used: 14097
Final two d classificationNumber classes: 280

-
Atomic model buiding 1

Initial modelPDB ID:
SoftwareName: Chimera, Yup.scx
DetailsProtocol: rigid body, Yup.scx simulated annealing. A complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters.
RefinementSpace: REAL / Protocol: RIGID BODY FIT / Target criteria: map-derived potential energy
Output model

PDB-3iyd:
Three-dimensional EM structure of an intact activator-dependent transcription initiation complex

-
Atomic model buiding 2

Initial modelPDB ID:
SoftwareName: Chimera, Yup.scx
DetailsProtocol: rigid body fit followed by Yup.scx simulated annealing. A complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters.
RefinementSpace: REAL / Protocol: RIGID BODY FIT / Target criteria: map-derived potential energy
Output model

PDB-3iyd:
Three-dimensional EM structure of an intact activator-dependent transcription initiation complex

-
Atomic model buiding 3

Initial modelPDB ID:

Chain - Chain ID: A
SoftwareName: Chimera, Yup.scx
DetailsProtocol: manual fit followed by Yup.scx simulated annealing. A complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters.
RefinementSpace: REAL / Protocol: RIGID BODY FIT / Target criteria: map-derived potential energy
Output model

PDB-3iyd:
Three-dimensional EM structure of an intact activator-dependent transcription initiation complex

-
Atomic model buiding 4

Initial modelPDB ID:

Chain - Chain ID: A
SoftwareName: Chimera, Yup.scx
DetailsProtocol: rigid body fit followed by Yup.scx simulated annealing. A complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters.
RefinementSpace: REAL / Protocol: RIGID BODY FIT / Target criteria: map-derived potential energy
Output model

PDB-3iyd:
Three-dimensional EM structure of an intact activator-dependent transcription initiation complex

-
Atomic model buiding 5

Initial modelPDB ID:
SoftwareName: Chimera, Modeller, Yup.scx
DetailsProtocol: rigid body fit followed by Yup.scx simulated annealing. A complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters.
RefinementSpace: REAL / Protocol: RIGID BODY FIT / Target criteria: map-derived potential energy
Output model

PDB-3iyd:
Three-dimensional EM structure of an intact activator-dependent transcription initiation complex

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more