[English] 日本語
- EMDB-5127: Three-dimensional EM structure of an intact activator-dependent t... -

Open data

ID or keywords:


no data

Basic information

Database: EMDB / ID: 5127
TitleThree-dimensional EM structure of an intact activator-dependent transcription initiation complex
Keywordstranscription / initiation / Class I / activator / RNA polymerase / holoenzyme / sigma70 / open complex / CAP / CRP / cAMP-dependent / DNA / prokaryotic
SampleE. coli RNA polymerase holoenzyme (sigma70) and E. coli catabolite activator protein (CAP) bound to 98-mer DNA containing the lac promoter and engineered open transcription bubble
SourceEscherichia coli / bacteria / エシェリキア・コリ, 大腸菌 /
Map dataE. coli Class I transcription activation complex
Methodsingle particle reconstruction, at 19.8 Å resolution
AuthorsHudson BP / Quispe J / Lara S / Kim Y / Berman HM / Arnold E / Ebright RH / Lawson CL
CitationProc. Natl. Acad. Sci. U.S.A., 2009, 106, 19830-19835

Proc. Natl. Acad. Sci. U.S.A., 2009, 106, 19830-19835 Yorodumi Papers
Three-dimensional EM structure of an intact activator-dependent transcription initiation complex.
Brian P Hudson / Joel Quispe / Samuel Lara-González / Younggyu Kim / Helen M Berman / Eddy Arnold / Richard H Ebright / Catherine L Lawson

Validation ReportPDB-ID: 3iyd

SummaryFull reportAbout validation report
DateDeposition: Jul 30, 2009 / Header (metadata) release: Aug 24, 2009 / Map release: Nov 4, 2009 / Last update: May 21, 2012

Structure visualization

  • Surface view with section colored by density value
  • Surface level: 2.8
  • Imaged by UCSF CHIMERA
  • Download
  • Surface view colored by radius
  • Surface level: 2.8
  • Imaged by UCSF CHIMERA
  • Download
  • Surface view with fitted model
  • Atomic models: : PDB-3iyd
  • Surface level: 2.8
  • Imaged by UCSF CHIMERA
  • Download
3D viewer

View / / Stereo:
Slabnear <=> far

fix: /
Orientation Rotation
Misc. /
Supplemental images

Downloads & links


Fileemd_5127.map.gz (map file in CCP4 format, 2001 KB)
Projections & slices

Image control

AxesZ (Sec.)Y (Row.)X (Col.)
80 pix
4.64 Å/pix.
= 371.2 Å
80 pix
4.64 Å/pix.
= 371.2 Å
80 pix
4.64 Å/pix.
= 371.2 Å



Slices (1/3)

Slices (1/2)

Slices (2/3)

Images are generated by Spider package.

Voxel sizeX=Y=Z: 4.64 Å
Contour Level:2.8 (by author), 2.8 (movie #1):
Minimum - Maximum-3.34078479 - 14.39524174
Average (Standard dev.)0E-8 (0.90271008)


Space Group Number1
Map Geometry
Axis orderXYZ
CellA=B=C: 371.19998 Å
α=β=γ: 90 deg.

CCP4 map header:

modeImage stored as Reals
Å/pix. X/Y/Z4.644.644.64
M x/y/z808080
origin x/y/z0.0000.0000.000
length x/y/z371.200371.200371.200
start NX/NY/NZ-34-26-72
MAP C/R/S123
start NC/NR/NS-40-40-40
D min/max/mean-3.34114.395-0.000

Supplemental data

Sample components

Entire E. coli RNA polymerase holoenzyme (sigma70) and E. coli catabolit...

EntireName: E. coli RNA polymerase holoenzyme (sigma70) and E. coli catabolite activator protein (CAP) bound to 98-mer DNA containing the lac promoter and engineered open transcription bubble
Details: Complex formation was verified by gel shift / Number of components: 3
Oligomeric State: One molecule of RNAP (containing six subunits) and one CAP homodimer bound to a DNA duplex)
MassTheoretical: 570 kDa

Component #1: protein, Catabolite Activator Protein

ProteinName: Catabolite Activator Protein / a.k.a: CAP / Oligomeric Details: homodimer / Number of Copies: 1 / Recombinant expression: Yes
MassTheoretical: 50 kDa
SourceSpecies: Escherichia coli / bacteria / エシェリキア・コリ, 大腸菌 /
Strain: K12
Source (engineered)Expression System: Escherichia coli bl21(de3) / bacteria / image: Escherichia coli
Vector: pET21(a)
External referencesGene Ontology: GO: 0006355 / InterPro: InterPro: 001808

Component #2: nucleic-acid, lac(ICAP)UP-UV5-bubble

Nucleic-acidName: lac(ICAP)UP-UV5-bubble / a.k.a: lac(ICAP)UP-UV5-bubble / Class: DNA
Details: An engineered 98mer duplex based on positions -78 to 20 of the Class I CAP-dependent promoter lac but containing consensus -10 sequence and consensus binding sites for CAP and RNAP alpha-CTD. Positions -11 to 2 are non-complementary to create an artificial transcription bubble. Top strand 5'-CGCAATAAATGTGATCTAGATCACATTTTAGGCAAAAAAGGCTTTACACTTTATGCTTCCGGCTCGTATAATCGCACCTTATGTGAGCGGATAACAAG-3' Bottom strand 5'-CTTGTTATCCGCTCACAATTCCACACTAATAACGAGCCGGAAGCATAAAGTGTAAAGCCTTTTTTGCCTAAAATGTGATCTAGATCACATTTATTGCG-3'
Structure: OTHER / Synthetic: Yes
MassTheoretical: 60 kDa / Experimental: 60 kDa
SourceSpecies: Unidentified

Component #3: protein, RNA polymerase holoenzyme (sigma70)

ProteinName: RNA polymerase holoenzyme (sigma70) / a.k.a: RNAP / Oligomeric Details: heterohexamer
Details: Six subunits include alphaI (RpoA), alphaII (RpoA), beta (RpoB), beta prime (RpoC) with C-terminal 6His-tag, omega (RpoZ), and sigma70.
Recombinant expression: Yes / Number of Copies: 1
MassTheoretical: 460 kDa
SourceSpecies: Escherichia coli / bacteria / エシェリキア・コリ, 大腸菌 /
Strain: K12
Source (engineered)Expression System: Escherichia coli bl21(de3) / bacteria / image: Escherichia coli
Vector: pEcABC-H6, pRSFduet-sigma, pCDF-omega
External referencesGene Ontology: GO: 0006351

Experimental details

Sample preparation

Specimen stateparticle
Sample solutionSpecimen conc.: 6.18 mg/ml
Buffer solution: 25mM HEPES, 100mM KCl, 10mM MgCl2, 1mM DTT, 0.2mM cAMP
pH: 8
Support film400-mesh copper 2.0x0.5 hole pattern C-flat grid covered with thin layer of continuous carbon
StainingSample and 2% uranyl formate stain were applied to the grid in rapid succession, with the last drop of stain remaining on the sample for 1 minute. The grid was then submerged in stain and brought up under thin carbon to form an upper sandwich layer. The grid was then blotted and dried for 10 minutes.
VitrificationInstrument: NONE / Cryogen name: NONE

Electron microscopy imaging

Experimental equipment
Model: Tecnai F20 / Image courtesy: FEI Company
ImagingMicroscope: FEI TECNAI F20 / Date: Nov 4, 2008 / Details: 15 um pixel size on detector
Electron gunElectron source: FIELD EMISSION GUN / Accelerating voltage: 120 kV / Electron dose: 16 e/Å2 / Illumination mode: FLOOD BEAM
LensMagnification: 50000 X (nominal) / Cs: 2 mm / Imaging mode: BRIGHT FIELD / Defocus: 500 - 1500 nm
Specimen HolderHolder: standard side-entry room-temperature stage / Model: SIDE ENTRY, EUCENTRIC / Temperature: 293 K
CameraDetector: TVIPS TEMCAM-F415 (4k x 4k)

Image acquisition

Image acquisitionNumber of digital images: 349

Image processing

ProcessingMethod: single particle reconstruction / Number of class averages: 280 / Number of projections: 14097
Details: 32816 particles were automatically selected by the Appion DoGpicker initially
Applied symmetry: C1 (asymmetric)
3D reconstructionAlgorithm: projection matching / Software: EMAN, SPIDER / CTF correction: ACE
Details: EMAN interleaved with SPIDER correspondence analysis
Resolution: 19.8 Å / Resolution method: FSC 0.5

Atomic model buiding

Modeling #1Software: Chimera, Yup.scx / Refinement protocol: rigid body / Target criteria: map-derived potential energy / Refinement space: REAL
Details: Protocol: rigid body, Yup.scx simulated annealing. A complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters.
Input PDB model: 1LB2
Modeling #2Software: Chimera, Yup.scx / Refinement protocol: rigid body / Target criteria: map-derived potential energy / Refinement space: REAL
Details: Protocol: rigid body fit followed by Yup.scx simulated annealing. A complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters.
Input PDB model: 1BDF
Modeling #3Software: Chimera, Yup.scx / Refinement protocol: rigid body / Target criteria: map-derived potential energy / Refinement space: REAL
Details: Protocol: manual fit followed by Yup.scx simulated annealing. A complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters.
Input PDB model: 2AUK
Chain ID: A
Modeling #4Software: Chimera, Yup.scx / Refinement protocol: rigid body / Target criteria: map-derived potential energy / Refinement space: REAL
Details: Protocol: rigid body fit followed by Yup.scx simulated annealing. A complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters.
Input PDB model: 1SIG
Chain ID: A
Modeling #5Software: Chimera, Modeller, Yup.scx / Refinement protocol: rigid body / Target criteria: map-derived potential energy / Refinement space: REAL
Details: Protocol: rigid body fit followed by Yup.scx simulated annealing. A complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters.
Input PDB model: 3DXJ
Output model

About Yorodumi


Oct 4, 2017. Three pioneers of this field were awarded Nobel Prize in Chemistry 2017

Three pioneers of this field were awarded Nobel Prize in Chemistry 2017

  • Jacques Dubochet (University of Lausanne, Switzerland) is a pioneer of ice-embedding method of EM specimen (as known as cryo-EM), Most of 3DEM structures in EMDB and PDB are obtained using his method.
  • Joachim Frank (Columbia University, New York, USA) is a pioneer of single particle reconstruction, which is the most used reconstruction method for 3DEM structures in EMDB and EM entries in PDB. And also, he is a develper of Spider, which is one of the most famous software in this field, and is used for some EM Navigor data (e.g. map projection/slice images).
  • Richard Henderson (MRC Laboratory of Molecular Biology, Cambridge, UK) was determined the first biomolecule structure by EM. The first EM entry in PDB, PDB-1brd is determinedby him.

External links: The 2017 Nobel Prize in Chemistry - Press Release

Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary. This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated. See below links for details.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software). Now, EM Navigator and Yorodumi are based on the updated data.

External links: wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

Jun 16, 2017. Omokage search with filter

Omokage search with filter

  • Result of Omokage search can be filtered by keywords and the database types

Related info.: Omokage search

Sep 15, 2016. EM Navigator & Yorodumi renewed

EM Navigator & Yorodumi renewed

  • New versions of EM Navigator and Yorodumi started

Related info.: Changes in new EM Navigator and Yorodumi / EM Navigator (legacy version) / Yorodumi (legacy version)

Aug 31, 2016. New EM Navigator & Yorodumi

New EM Navigator & Yorodumi

  • In 15th Sep 2016, the development versions of EM Navigator and Yorodumi will replace the official versions.
  • Current version will continue as 'legacy version' for some time.

Related info.: Changes in new EM Navigator and Yorodumi / EM Navigator / Yorodumi / EM Navigator (legacy version) / Yorodumi (legacy version)

Read more


Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • All the functionalities will be ported from the levgacy version.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.

Related info.: Yorodumi (legacy version) / EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Yorodumi Papers / Jmol/JSmol / Changes in new EM Navigator and Yorodumi

Read more