Author results

1AOI
  • Download 1aoi
  • View 1aoi
Molmil generated image of 1aoi
COMPLEX BETWEEN NUCLEOSOME CORE PARTICLE (H3,H4,H2A,H2B) AND 146 BP LONG DNA FRAGMENT
Descriptor:PALINDROMIC 146 BP DNA REPEAT 8/9 FROM HUMAN X-CHROMOSOME ALPHA SATELLITE DNA, HISTONE H3, HISTONE H4, ...
Authors:Luger, K., Maeder, A.W., Richmond, R.K., Sargent, D.F., Richmond, T.J.
Deposit date:1997-07-03
Release date:1998-09-30
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.8 Å)
Cite:Crystal structure of the nucleosome core particle at 2.8 A resolution.
Nature, 389, 1997
2NQB
  • Download 2nqb
  • View 2nqb
Molmil generated image of 2nqb
DROSOPHILA NUCLEOSOME STRUCTURE
Descriptor:alpha-satellite DNA, Histone H3, Histone H4, ...
Authors:Luger, K., Chakravarthy, S.
Deposit date:2006-10-30
Release date:2007-09-11
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.3 Å)
Cite:Comparative analysis of nucleosome structures from different species.
To be Published
1EYN
  • Download 1eyn
  • View 1eyn
Molmil generated image of 1eyn
STRUCTURE OF MURA LIGANDED WITH THE EXTRINSIC FLUORESCENCE PROBE ANS
Descriptor:UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE, 8-ANILINO-1-NAPHTHALENE SULFONATE, GLYCEROL
Authors:Schonbrunn, E., Eschenburg, S., Luger, K., Kabsch, W., Amrhein, N.
Deposit date:2000-05-07
Release date:2000-06-09
Last modified:2011-07-27
Method:X-RAY DIFFRACTION (1.7 Å)
Cite:Structural basis for the interaction of the fluorescence probe 8-anilino-1-naphthalene sulfonate (ANS) with the antibiotic target MurA.
Proc.Natl.Acad.Sci.USA, 97, 2000
1KX3
  • Download 1kx3
  • View 1kx3
Molmil generated image of 1kx3
X-RAY STRUCTURE OF THE NUCLEOSOME CORE PARTICLE, NCP146, AT 2.0 A RESOLUTION
Descriptor:DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3'), histone H3, histone H4, ...
Authors:Davey, C.A., Sargent, D.F., Luger, K., Maeder, A.W., Richmond, T.J.
Deposit date:2002-01-31
Release date:2002-12-25
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2 Å)
Cite:Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
1KX4
  • Download 1kx4
  • View 1kx4
Molmil generated image of 1kx4
X-RAY STRUCTURE OF THE NUCLEOSOME CORE PARTICLE, NCP146B, AT 2.6 A RESOLUTION
Descriptor:DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3'), histone H3, histone H4, ...
Authors:Davey, C.A., Sargent, D.F., Luger, K., Maeder, A.W., Richmond, T.J.
Deposit date:2002-01-31
Release date:2002-12-25
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.6 Å)
Cite:Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
1KX5
  • Download 1kx5
  • View 1kx5
Molmil generated image of 1kx5
X-RAY STRUCTURE OF THE NUCLEOSOME CORE PARTICLE, NCP147, AT 1.9 A RESOLUTION
Descriptor:DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), histone H3, ...
Authors:Davey, C.A., Sargent, D.F., Luger, K., Maeder, A.W., Richmond, T.J.
Deposit date:2002-01-31
Release date:2002-12-25
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (1.94 Å)
Cite:Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
5T5K
  • Download 5t5k
  • View 5t5k
Molmil generated image of 5t5k
STRUCTURE OF HISTONE-BASED CHROMATIN IN ARCHAEA
Descriptor:DNA-binding protein HMf-2, DNA (90-MER), CACODYLATE ION
Authors:Bhattacharyya, S., Mattiroli, F., Dyer, P.N., Sandman, K., Reeve, J.N., Luger, K.
Deposit date:2016-08-31
Release date:2017-08-23
Method:X-RAY DIFFRACTION (4 Å)
Cite:Structure of histone-based chromatin in Archaea.
Science, 357, 2017
6C0W
  • Download 6c0w
  • View 6c0w
Molmil generated image of 6c0w
CRYO-EM STRUCTURE OF HUMAN KINETOCHORE PROTEIN CENP-N WITH THE CENTROMERIC NUCLEOSOME CONTAINING CENP-A
Descriptor:Histone H3-like centromeric protein A, Histone H4, Histone H2A, ...
Authors:Zhou, K., Pentakota, S., Vetter, I.R., Morgan, G.P., Petrovic, A., Musacchio, A., Luger, K.
Deposit date:2018-01-02
Release date:2018-01-17
Method:ELECTRON MICROSCOPY (4 Å)
Cite:Decoding the centromeric nucleosome through CENP-N.
Elife, 6, 2017
3C1B
  • Download 3c1b
  • View 3c1b
Molmil generated image of 3c1b
THE EFFECT OF H3 K79 DIMETHYLATION AND H4 K20 TRIMETHYLATION ON NUCLEOSOME AND CHROMATIN STRUCTURE
Descriptor:Histone H3-like, Histone H4, Histone H2A type 1, ...
Authors:Lu, X., Simon, M., Chodaparambil, J., Hansen, J., Shokat, K., Luger, K.
Deposit date:2008-01-22
Release date:2008-10-07
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.2 Å)
Cite:The effect of H3K79 dimethylation and H4K20 trimethylation on nucleosome and chromatin structure.
Nat.Struct.Mol.Biol., 15, 2008
3C1C
  • Download 3c1c
  • View 3c1c
Molmil generated image of 3c1c
THE EFFECT OF H3 K79 DIMETHYLATION AND H4 K20 TRIMETHYLATION ON NUCLEOSOME AND CHROMATIN STRUCTURE
Descriptor:Histone H3-like, Histone H4, Histone H2A type 1, ...
Authors:Lu, X., Simon, M., Chodaparambil, J., Hansen, J., Shokat, K., Luger, K.
Deposit date:2008-01-22
Release date:2008-10-07
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3.15 Å)
Cite:The effect of H3K79 dimethylation and H4K20 trimethylation on nucleosome and chromatin structure.
Nat.Struct.Mol.Biol., 15, 2008
1DLG
  • Download 1dlg
  • View 1dlg
Molmil generated image of 1dlg
CRYSTAL STRUCTURE OF THE C115S ENTEROBACTER CLOACAE MURA IN THE UN-LIGANDED STATE
Descriptor:UDP-N-ACETYLGLUCOSAMINE ENOLPYRUVYL TRANSFERASE MURA, PHOSPHATE ION, CYCLOHEXYLAMMONIUM ION
Authors:Schonbrunn, E., Eschenburg, S., Krekel, F., Luger, K., Amrhein, N.
Deposit date:1999-12-09
Release date:2000-04-12
Last modified:2011-11-16
Method:X-RAY DIFFRACTION (1.9 Å)
Cite:Role of the loop containing residue 115 in the induced-fit mechanism of the bacterial cell wall biosynthetic enzyme MurA.
Biochemistry, 39, 2000
1F66
  • Download 1f66
  • View 1f66
Molmil generated image of 1f66
2.6 A CRYSTAL STRUCTURE OF A NUCLEOSOME CORE PARTICLE CONTAINING THE VARIANT HISTONE H2A.Z
Descriptor:PALINDROMIC 146 BASE PAIR DNA FRAGMENT, HISTONE H3, HISTONE H4, ...
Authors:Suto, R.K., Clarkson, M.J., Tremethick, D.J., Luger, K.
Deposit date:2000-06-20
Release date:2000-11-27
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.6 Å)
Cite:Crystal structure of a nucleosome core particle containing the variant histone H2A.Z.
Nat.Struct.Biol., 7, 2000
1ID3
  • Download 1id3
  • View 1id3
Molmil generated image of 1id3
CRYSTAL STRUCTURE OF THE YEAST NUCLEOSOME CORE PARTICLE REVEALS FUNDAMENTAL DIFFERENCES IN INTER-NUCLEOSOME INTERACTIONS
Descriptor:PALINDROMIC 146BP DNA FRAGMENT, HISTONE H3, HISTONE H4, ...
Authors:White, C.L., Suto, R.K., Luger, K.
Deposit date:2001-04-03
Release date:2001-09-28
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3.1 Å)
Cite:Structure of the yeast nucleosome core particle reveals fundamental changes in internucleosome interactions.
EMBO J., 20, 2001
1M18
  • Download 1m18
  • View 1m18
Molmil generated image of 1m18
LIGAND BINDING ALTERS THE STRUCTURE AND DYNAMICS OF NUCLEOSOMAL DNA
Descriptor:Palindromic 146 Base Pair DNA Fragment, Histone H3.2, Histone H4, ...
Authors:Suto, R.K., Edayathumangalam, R.S., White, C.L., Melander, C., Gottesfeld, J.M., Dervan, P.B., Luger, K.
Deposit date:2002-06-18
Release date:2003-02-18
Last modified:2013-07-17
Method:X-RAY DIFFRACTION (2.45 Å)
Cite:Crystal Structures of Nucleosome Core Particles in Complex with Minor Groove DNA-binding Ligands
J.Mol.Biol., 326, 2003
1M19
  • Download 1m19
  • View 1m19
Molmil generated image of 1m19
LIGAND BINDING ALTERS THE STRUCTURE AND DYNAMICS OF NUCLEOSOMAL DNA
Descriptor:Palindromic 146 Base Pair DNA Fragment, Histone H3.2, Histone H4, ...
Authors:Suto, R.K., Edayathumangalam, R.S., White, C.L., Melander, C., Gottesfeld, J.M., Dervan, P.B., Luger, K.
Deposit date:2002-06-18
Release date:2003-02-18
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.3 Å)
Cite:Crystal Structures of Nucleosome Core Particles in Complex with Minor Groove DNA-binding Ligands
J.Mol.Biol., 326, 2003
1M1A
  • Download 1m1a
  • View 1m1a
Molmil generated image of 1m1a
LIGAND BINDING ALTERS THE STRUCTURE AND DYNAMICS OF NUCLEOSOMAL DNA
Descriptor:Palindromic 146 Base Pair DNA Fragment, Histone H3.2, Histone H4, ...
Authors:Suto, R.K., Edayathumangalam, R.S., White, C.L., Melander, C., Gottesfeld, J.M., Dervan, P.B., Luger, K.
Deposit date:2002-06-18
Release date:2003-02-18
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.65 Å)
Cite:Crystal Structures of Nucleosome Core Particles in Complex with Minor Groove DNA-binding Ligands
J.MOL.BIOL., 326, 2003
1P34
  • Download 1p34
  • View 1p34
Molmil generated image of 1p34
CRYSTALLOGRAPHIC STUDIES OF NUCLEOSOME CORE PARTICLES CONTAINING HISTONE 'SIN' MUTANTS
Descriptor:Palindromic 146bp Human Alpha-Satellite DNA fragment, Histone H3, Histone H4, ...
Authors:Muthurajan, U.M., Bao, Y., Forsberg, L.J., Edayathumangalam, R.S., Dyer, P.N., White, C.L., Luger, K.
Deposit date:2003-04-17
Release date:2004-02-24
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.7 Å)
Cite:Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions
EMBO J., 23, 2004
1P3A
  • Download 1p3a
  • View 1p3a
Molmil generated image of 1p3a
CRYSTALLOGRAPHIC STUDIES OF NUCLEOSOME CORE PARTICLES CONTAINING HISTONE 'SIN' MUTANTS
Descriptor:Palindromic 146bp Human Alpha-Satellite DNA fragment, Histone H3, Histone H4, ...
Authors:Muthurajan, U.M., Bao, Y., Forsberg, L.J., Edayathumangalam, R.S., Dyer, P.N., White, C.L., Luger, K.
Deposit date:2003-04-17
Release date:2004-02-24
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3 Å)
Cite:Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions
EMBO J., 23, 2004
1P3B
  • Download 1p3b
  • View 1p3b
Molmil generated image of 1p3b
CRYSTALLOGRAPHIC STUDIES OF NUCLEOSOME CORE PARTICLES CONTAINING HISTONE 'SIN' MUTANTS
Descriptor:Palindromic 146bp Human Alpha-Satellite DNA fragment, Histone H3, Histone H4, ...
Authors:Muthurajan, U.M., Bao, Y., Forsberg, L.J., Edayathumangalam, R.S., Dyer, P.N., White, C.L., Luger, K.
Deposit date:2003-04-17
Release date:2004-02-24
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3 Å)
Cite:Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions
EMBO J., 23, 2004
1P3F
  • Download 1p3f
  • View 1p3f
Molmil generated image of 1p3f
CRYSTALLOGRAPHIC STUDIES OF NUCLEOSOME CORE PARTICLES CONTAINING HISTONE 'SIN' MUTANTS
Descriptor:Palindromic 146bp Human Alpha-Satellite DNA fragment, Histone H3, Histone H4, ...
Authors:Muthurajan, U.M., Bao, Y., Forsberg, L.J., Edayathumangalam, R.S., Dyer, P.N., White, C.L., Luger, K.
Deposit date:2003-04-17
Release date:2004-02-24
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.9 Å)
Cite:Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions
EMBO J., 23, 2004
1P3G
  • Download 1p3g
  • View 1p3g
Molmil generated image of 1p3g
CRYSTALLOGRAPHIC STUDIES OF NUCLEOSOME CORE PARTICLES CONTAINING HISTONE 'SIN' MUTANTS
Descriptor:Palindromic 146bp Human Alpha-Satellite DNA fragment, Histone H3, Histone H4, ...
Authors:Muthurajan, U.M., Bao, Y., Forsberg, L.J., Edayathumangalam, R.S., Dyer, P.N., White, C.L., Luger, K.
Deposit date:2003-04-17
Release date:2004-02-24
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.7 Å)
Cite:Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions
EMBO J., 23, 2004
1P3I
  • Download 1p3i
  • View 1p3i
Molmil generated image of 1p3i
CRYSTALLOGRAPHIC STUDIES OF NUCLEOSOME CORE PARTICLES CONTAINING HISTONE 'SIN' MUTANTS
Descriptor:Palindromic 146bp Human Alpha-Satellite DNA fragment, Histone H3, Histone H4, ...
Authors:Muthurajan, U.M., Bao, Y., Forsberg, L.J., Edayathumangalam, R.S., Dyer, P.N., White, C.L., Luger, K.
Deposit date:2003-04-17
Release date:2004-02-24
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.3 Å)
Cite:Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions
EMBO J., 23, 2004
1P3K
  • Download 1p3k
  • View 1p3k
Molmil generated image of 1p3k
CRYSTALLOGRAPHIC STUDIES OF NUCLEOSOME CORE PARTICLES CONTAINING HISTONE 'SIN' MUTANTS
Descriptor:Palindromic 146bp Human Alpha-Satellite DNA fragment, Histone H3, Histone H4, ...
Authors:Muthurajan, U.M., Bao, Y., Forsberg, L.J., Edayathumangalam, R.S., Dyer, P.N., White, C.L., Luger, K.
Deposit date:2003-04-17
Release date:2004-02-24
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.9 Å)
Cite:Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions
EMBO J., 23, 2004
1P3L
  • Download 1p3l
  • View 1p3l
Molmil generated image of 1p3l
CRYSTALLOGRAPHIC STUDIES OF NUCLEOSOME CORE PARTICLES CONTAINING HISTONE 'SIN' MUTANTS
Descriptor:Palindromic 146bp Human Alpha-Satellite DNA fragment, Histone H3, Histone H4, ...
Authors:Muthurajan, U.M., Bao, Y., Forsberg, L.J., Edayathumangalam, R.S., Dyer, P.N., White, C.L., Luger, K.
Deposit date:2003-04-17
Release date:2004-02-24
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.4 Å)
Cite:Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions
EMBO J., 23, 2004
1P3M
  • Download 1p3m
  • View 1p3m
Molmil generated image of 1p3m
CRYSTALLOGRAPHIC STUDIES OF NUCLEOSOME CORE PARTICLES CONTAINING HISTONE 'SIN' MUTANTS
Descriptor:Palindromic 146bp Human Alpha-Satellite DNA fragment, Histone H3, Histone H4, ...
Authors:Muthurajan, U.M., Bao, Y., Forsberg, L.J., Edayathumangalam, R.S., Dyer, P.N., White, C.L., Luger, K.
Deposit date:2003-04-17
Release date:2004-02-24
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.9 Å)
Cite:Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions
EMBO J., 23, 2004
<123>