6P0S
 
 | | Crystal structure of ternary DNA complex "FX2" containing E. coli Fis and phage lambda Xis | | Descriptor: | DNA (27-MER), FX1-2, DNA-binding protein Fis, ... | | Authors: | Hancock, S.P, Cascio, D, Johnson, R.C. | | Deposit date: | 2019-05-17 | | Release date: | 2019-06-19 | | Last modified: | 2023-10-11 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Cooperative DNA binding by proteins through DNA shape complementarity.
Nucleic Acids Res., 47, 2019
|
|
6QQ5
 | | Cryo-EM structure of dimeric quinol dependent nitric oxide reductase (qNOR) from Alcaligenes xylosoxidans | | Descriptor: | CALCIUM ION, FE (III) ION, Nitric oxide reductase subunit B, ... | | Authors: | Gopalasingam, C.C, Johnson, R.M, Chiduza, G.N, Tosha, T, Yamamoto, M, Shiro, Y, Antonyuk, S.V, Muench, S.P, Hasnain, S.S. | | Deposit date: | 2019-02-17 | | Release date: | 2019-09-11 | | Last modified: | 2024-05-15 | | Method: | ELECTRON MICROSCOPY (3.9 Å) | | Cite: | Dimeric structures of quinol-dependent nitric oxide reductases (qNORs) revealed by cryo-electron microscopy.
Sci Adv, 5, 2019
|
|
4EEY
 | | Crystal structure of human DNA polymerase eta in ternary complex with a cisplatin DNA adduct | | Descriptor: | 2'-DEOXYCYTIDINE-5'-TRIPHOSPHATE, 5'-D(*CP*TP*TP*GP*GP*TP*CP*TP*CP*CP*TP*CP*C)-3', 5'-D(*TP*GP*GP*AP*GP*GP*AP*GP*A)-3', ... | | Authors: | Ummat, A, Rechkoblit, O, Jain, R, Choudhury, J.R, Johnson, R.E, Silverstein, T.D, Buku, A, Lone, S, Prakash, L, Prakash, S, Aggarwal, A.K. | | Deposit date: | 2012-03-28 | | Release date: | 2012-05-09 | | Last modified: | 2023-09-13 | | Method: | X-RAY DIFFRACTION (2.32 Å) | | Cite: | Structural basis for cisplatin DNA damage tolerance by human polymerase {eta} during cancer chemotherapy.
Nat.Struct.Mol.Biol., 19, 2012
|
|
6T6V
 | | Glu-494-Ala inactive monomer of a quinol dependent Nitric Oxide Reductase (qNOR) from Alcaligenes xylosoxidans | | Descriptor: | CALCIUM ION, Nitric oxide reductase subunit B, PROTOPORPHYRIN IX CONTAINING FE | | Authors: | Gopalasingam, C.C, Johnson, R.M, Antonyuk, S.V, Muench, S.P, Hasnain, S.S. | | Deposit date: | 2019-10-19 | | Release date: | 2020-04-01 | | Last modified: | 2020-05-27 | | Method: | ELECTRON MICROSCOPY (4.5 Å) | | Cite: | The active form of quinol-dependent nitric oxide reductase fromNeisseria meningitidisis a dimer.
Iucrj, 7, 2020
|
|
1LX8
 | | Regulation of directionality in bacteriophage lambda site-specific recombination: structure of the Xis protein | | Descriptor: | Excisionase | | Authors: | Sam, M.D, Papagiannis, C, Connolly, K.M, Corselli, L, Iwahara, J, Lee, J, Phillips, M, Wojciak, J.M, Johnson, R.C, Clubb, R.T. | | Deposit date: | 2002-06-04 | | Release date: | 2003-06-10 | | Last modified: | 2021-10-27 | | Method: | SOLUTION NMR | | Cite: | Regulation of directionality in bacteriophage lambda site-specific recombination: structure of the Xis protein
J.Mol.Biol., 324, 2002
|
|
3FIS
 | | THE MOLECULAR STRUCTURE OF WILD-TYPE AND A MUTANT FIS PROTEIN: RELATIONSHIP BETWEEN MUTATIONAL CHANGES AND RECOMBINATIONAL ENHANCER FUNCTION OR DNA BINDING | | Descriptor: | FACTOR FOR INVERSION STIMULATION (FIS) | | Authors: | Yuan, H.S, Finkel, S.E, Feng, J-A, Johnson, R.C, Dickerson, R.E. | | Deposit date: | 1991-08-12 | | Release date: | 1993-10-31 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | The molecular structure of wild-type and a mutant Fis protein: relationship between mutational changes and recombinational enhancer function or DNA binding.
Proc.Natl.Acad.Sci.USA, 88, 1991
|
|
5DTD
 | |
3H4B
 | | Ternary complex of human DNA polymerase iota with template U/T and incoming dATP | | Descriptor: | 2'-DEOXYADENOSINE 5'-TRIPHOSPHATE, 5'-D(*AP*GP*GP*AP*CP*CP*(DOC))-3', 5'-D(*TP*(BRU)P*GP*GP*GP*TP*CP*CP*T)-3', ... | | Authors: | Jain, R, Nair, D.T, Johnson, R.E, Prakash, L, Prakash, S, Aggarwal, A.K. | | Deposit date: | 2009-04-18 | | Release date: | 2009-07-21 | | Last modified: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (2.85 Å) | | Cite: | Replication across template T/U by human DNA polymerase-iota.
Structure, 17, 2009
|
|
5E3L
 | |
5DS9
 | |
5E3O
 | |
5E3N
 | |
3H40
 | | Binary complex of human DNA polymerase iota with template U/T | | Descriptor: | 5'-D(*AP*GP*GP*AP*CP*CP*(DOC))-3', 5'-D(*TP*(BRU)P*GP*GP*GP*TP*CP*CP*T)-3', DNA polymerase iota, ... | | Authors: | Jain, R, Nair, D.T, Johnson, R.E, Prakash, L, Prakash, S, Aggarwal, A.K. | | Deposit date: | 2009-04-17 | | Release date: | 2009-07-21 | | Last modified: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Replication across template T/U by human DNA polymerase-iota.
Structure, 17, 2009
|
|
3H4D
 | | Ternary complex of human DNA polymerase iota with template U/T and incoming dGTP | | Descriptor: | 2'-DEOXYGUANOSINE-5'-TRIPHOSPHATE, 5'-D(*AP*GP*GP*AP*CP*CP*(DOC)), 5'-D(*TP*(BRU)P*GP*GP*GP*TP*CP*CP*T), ... | | Authors: | Jain, R, Nair, D.T, Johnson, R.E, Prakash, L, Prakash, S, Aggarwal, A.K. | | Deposit date: | 2009-04-18 | | Release date: | 2009-07-21 | | Last modified: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Replication across template T/U by human DNA polymerase-iota.
Structure, 17, 2009
|
|
5E3M
 | | Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) | | Descriptor: | DNA (27-MER), DNA-binding protein Fis | | Authors: | Stella, S, Hancock, S.P, Cascio, D, Johnson, R.C. | | Deposit date: | 2015-10-03 | | Release date: | 2016-03-09 | | Last modified: | 2022-03-23 | | Method: | X-RAY DIFFRACTION (2.886 Å) | | Cite: | DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Plos One, 11, 2016
|
|
5FM1
 | | Structure of gamma-tubulin small complex based on a cryo-EM map, chemical cross-links, and a remotely related structure | | Descriptor: | SPINDLE POLE BODY COMPONENT 110, SPINDLE POLE BODY COMPONENT SPC97, SPINDLE POLE BODY COMPONENT SPC98, ... | | Authors: | Greenberg, C.H, Kollman, J, Zelter, A, Johnson, R, MacCoss, M.J, Davis, T.N, Agard, D.A, Sali, A. | | Deposit date: | 2015-10-30 | | Release date: | 2016-02-03 | | Last modified: | 2024-05-08 | | Method: | ELECTRON MICROSCOPY (8 Å) | | Cite: | Structure of Gamma-Tubulin Small Complex Based on a Cryo-Em Map, Chemical Cross-Links, and a Remotely Related Structure.
J.Struct.Biol., 194, 2016
|
|
5FLZ
 | | Cryo-EM structure of gamma-TuSC oligomers in a closed conformation | | Descriptor: | SPINDLE POLE BODY COMPONENT 110, SPINDLE POLE BODY COMPONENT SPC97, SPINDLE POLE BODY COMPONENT SPC98, ... | | Authors: | Greenberg, C.H, Kollman, J, Zelter, A, Johnson, R, MacCoss, M.J, Davis, T.N, Agard, D.A, Sali, A. | | Deposit date: | 2015-10-29 | | Release date: | 2016-01-13 | | Last modified: | 2024-05-08 | | Method: | ELECTRON MICROSCOPY (6.9 Å) | | Cite: | Structure of Gamma-Tubulin Small Complex Based on a Cryo-Em Map, Chemical Cross-Links, and a Remotely Related Structure.
J.Struct.Biol., 194, 2016
|
|
6DGB
 | | Crystal structure of the C-terminal catalytic domain of IS1535 TnpA, an IS607-like serine recombinase | | Descriptor: | IS607 family transposase IS1535 | | Authors: | Chen, W.Y, Hancock, S.P, Cascio, D, Johnson, R.C. | | Deposit date: | 2018-05-17 | | Release date: | 2018-07-18 | | Last modified: | 2024-03-13 | | Method: | X-RAY DIFFRACTION (2.52 Å) | | Cite: | Multiple serine transposase dimers assemble the transposon-end synaptic complex during IS607-family transposition.
Elife, 7, 2018
|
|
6DGC
 | | Crystal structure of the C-terminal catalytic domain of ISC1926 TnpA, an IS607-like serine recombinase | | Descriptor: | ISC1926 TnpA C-terminal catalytic domain | | Authors: | Hancock, S.P, Kumar, P, Cascio, D, Johnson, R.C. | | Deposit date: | 2018-05-17 | | Release date: | 2018-07-18 | | Last modified: | 2023-10-11 | | Method: | X-RAY DIFFRACTION (2.92 Å) | | Cite: | Multiple serine transposase dimers assemble the transposon-end synaptic complex during IS607-family transposition.
Elife, 7, 2018
|
|
1ETQ
 | |
1ETV
 | |
1ETW
 | |
6L3H
 | | Cryo-EM structure of dimeric quinol dependent Nitric Oxide Reductase (qNOR) from the pathogen Neisseria meninigitidis | | Descriptor: | CALCIUM ION, FE (III) ION, Nitric-oxide reductase, ... | | Authors: | Jamali, M.M.A, Gopalasingam, C.C, Johnson, R.M, Tosha, T, Muench, S.P, Muramoto, K, Antonyuk, S.V, Shiro, Y, Hasnain, S.S. | | Deposit date: | 2019-10-11 | | Release date: | 2020-04-01 | | Last modified: | 2024-03-27 | | Method: | ELECTRON MICROSCOPY (3.06 Å) | | Cite: | The active form of quinol-dependent nitric oxide reductase fromNeisseria meningitidisis a dimer.
Iucrj, 7, 2020
|
|
1JIH
 | | Yeast DNA Polymerase ETA | | Descriptor: | DNA Polymerase ETA | | Authors: | Trincao, J, Johnson, R.E, Escalante, C.R, Prakash, S, Prakash, L, Aggarwal, A.K. | | Deposit date: | 2001-07-02 | | Release date: | 2002-01-09 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (2.25 Å) | | Cite: | Structure of the catalytic core of S. cerevisiae DNA polymerase eta: implications for translesion DNA synthesis
Mol.Cell, 8, 2001
|
|
1LV2
 | | Hepatocyte Nuclear Factor 4 is a Transcription Factor that Constitutively Binds Fatty Acids | | Descriptor: | Hepatocyte nuclear factor 4-gamma, PALMITIC ACID | | Authors: | Wisely, B, Miller, A.B, Davis, R.G, Spitzer, T, Shearer, B, Moore, J.T, Johnson, R, Sefler, A, Willson, T.M, Williams, S.P. | | Deposit date: | 2002-05-24 | | Release date: | 2002-12-18 | | Last modified: | 2024-04-03 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Hepatocyte Nuclear Factor 4 Is a Transcription Factor
that Constitutively Binds Fatty Acids.
Structure, 10, 2002
|
|
