3PT2
| Structure of a viral OTU domain protease bound to Ubiquitin | Descriptor: | 1.7.6 3-bromanylpropan-1-amine, ACETATE ION, RNA polymerase, ... | Authors: | James, T.W, Bacik, J.P, Frias-Staheli, N, Garcia-Sastre, A, Mark, B.L. | Deposit date: | 2010-12-02 | Release date: | 2011-01-19 | Last modified: | 2023-05-31 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | Structural basis for the removal of ubiquitin and interferon-stimulated gene 15 by a viral ovarian tumor domain-containing protease. Proc.Natl.Acad.Sci.USA, 108, 2011
|
|
1B10
| SOLUTION NMR STRUCTURE OF RECOMBINANT SYRIAN HAMSTER PRION PROTEIN RPRP(90-231) , 25 STRUCTURES | Descriptor: | PROTEIN (PRION PROTEIN) | Authors: | James, T.L, Liu, H, Ulyanov, N.B, Farr-Jones, S. | Deposit date: | 1998-11-25 | Release date: | 1998-12-02 | Last modified: | 2023-12-27 | Method: | SOLUTION NMR | Cite: | Solution structure of a 142-residue recombinant prion protein corresponding to the infectious fragment of the scrapie isoform. Proc.Natl.Acad.Sci.USA, 94, 1997
|
|
2P2R
| Crystal structure of the third KH domain of human Poly(C)-Binding Protein-2 in complex with C-rich strand of human telomeric DNA | Descriptor: | 6-AMINOPYRIMIDIN-2(1H)-ONE, C-rich strand of human telomeric DNA, Poly(rC)-binding protein 2 | Authors: | James, T.L, Stroud, R.M, Du, Z, Fenn, S, Tjhen, R, Lee, J.K. | Deposit date: | 2007-03-07 | Release date: | 2007-06-12 | Last modified: | 2019-07-24 | Method: | X-RAY DIFFRACTION (1.6 Å) | Cite: | Crystal structure of the third KH domain of human poly(C)-binding protein-2 in complex with a C-rich strand of human telomeric DNA at 1.6 A resolution. Nucleic Acids Res., 35, 2007
|
|
2PQU
| |
2PY9
| |
1D42
| |
1CQ5
| NMR STRUCTURE OF SRP RNA DOMAIN IV | Descriptor: | SRP RNA DOMAIN IV | Authors: | Schmitz, U, James, T.L, Behrens, S, Freymann, D.M, Lukavsky, P, Walter, P. | Deposit date: | 1999-08-05 | Release date: | 1999-08-23 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | Structure of the phylogenetically most conserved domain of SRP RNA. RNA, 5, 1999
|
|
1CQL
| |
1D70
| |
141D
| |
142D
| |
140D
| SOLUTION STRUCTURE OF A CONSERVED DNA SEQUENCE FROM THE HIV-1 GENOME: RESTRAINED MOLECULAR DYNAMICS SIMULATION WITH DISTANCE AND TORSION ANGLE RESTRAINTS DERIVED FROM TWO-DIMENSIONAL NMR SPECTRA | Descriptor: | DNA (5'-D(*AP*GP*CP*TP*TP*GP*CP*CP*TP*TP*GP*AP*G)-3'), DNA (5'-D(*CP*TP*CP*AP*AP*GP*GP*CP*AP*AP*GP*CP*T)-3') | Authors: | Mujeeb, A, Kerwin, S.M, Kenyon, G.L, James, T.L. | Deposit date: | 1993-09-24 | Release date: | 1994-04-30 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | Solution structure of a conserved DNA sequence from the HIV-1 genome: restrained molecular dynamics simulation with distance and torsion angle restraints derived from two-dimensional NMR spectra. Biochemistry, 32, 1993
|
|
1BAU
| NMR STRUCTURE OF THE DIMER INITIATION COMPLEX OF HIV-1 GENOMIC RNA, MINIMIZED AVERAGE STRUCTURE | Descriptor: | SL1 RNA DIMER | Authors: | Mujeeb, A, Clever, J.L, Billeci, T.M, James, T.L, Parslow, T.G. | Deposit date: | 1998-04-18 | Release date: | 1999-04-27 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | Structure of the dimer initiation complex of HIV-1 genomic RNA. Nat.Struct.Biol., 5, 1998
|
|
3PSE
| Structure of a viral OTU domain protease bound to interferon-stimulated gene 15 (ISG15) | Descriptor: | 1.7.6 3-bromanylpropan-1-amine, GLYCEROL, RNA polymerase, ... | Authors: | Bacik, J.P, James, T.W, Frias-Staheli, N, Garcia-Sastre, A, Mark, B.L. | Deposit date: | 2010-12-01 | Release date: | 2011-01-19 | Last modified: | 2023-09-20 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | Structural basis for the removal of ubiquitin and interferon-stimulated gene 15 by a viral ovarian tumor domain-containing protease. Proc.Natl.Acad.Sci.USA, 108, 2011
|
|
4IUM
| Equine arteritis virus papain-like protease 2 (PLP2) covalently bound to ubiquitin | Descriptor: | GLYCEROL, Ubiquitin, ZINC ION, ... | Authors: | Bailey-Elkin, B.A, James, T.W, Mark, B.L. | Deposit date: | 2013-01-21 | Release date: | 2013-02-13 | Last modified: | 2013-03-20 | Method: | X-RAY DIFFRACTION (1.45 Å) | Cite: | Deubiquitinase function of arterivirus papain-like protease 2 suppresses the innate immune response in infected host cells. Proc.Natl.Acad.Sci.USA, 110, 2013
|
|
219D
| |
3C4B
| Structure of RNaseIIIb and dsRNA binding domains of mouse Dicer | Descriptor: | Endoribonuclease Dicer | Authors: | Lee, J.K, Du, Z, Tjhen, R.J, Stroud, R.M, James, T.L. | Deposit date: | 2008-01-29 | Release date: | 2008-02-19 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (1.68 Å) | Cite: | Structural and biochemical insights into the dicing mechanism of mouse Dicer: A conserved lysine is critical for dsRNA cleavage. Proc.Natl.Acad.Sci.Usa, 105, 2008
|
|
3C4T
| Structure of RNaseIIIb and dsRNA binding domains of mouse Dicer | Descriptor: | CADMIUM ION, Endoribonuclease Dicer | Authors: | Lee, J.K, Du, Z, Tjhen, R.J, Stroud, R.M, James, T.L. | Deposit date: | 2008-01-30 | Release date: | 2008-02-19 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | Structural and biochemical insights into the dicing mechanism of mouse Dicer: A conserved lysine is critical for dsRNA cleavage. Proc.Natl.Acad.Sci.Usa, 105, 2008
|
|
2AXY
| Crystal Structure of KH1 domain of human Poly(C)-binding protein-2 with C-rich strand of human telomeric DNA | Descriptor: | C-rich strand of human telomeric dna, Poly(rC)-binding protein 2 | Authors: | Du, Z, Lee, J.K, Tjhen, R.J, Li, S, Stroud, R.M, James, T.L. | Deposit date: | 2005-09-06 | Release date: | 2005-09-27 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (1.7 Å) | Cite: | Crystal Structure of the First KH Domain of Human Poly(C)-binding Protein-2 in Complex with a C-rich Strand of Human Telomeric DNA at 1.7 A J.Biol.Chem., 280, 2005
|
|
2GM0
| Linear dimer of stemloop SL1 from HIV-1 | Descriptor: | RNA (35-MER) | Authors: | Ulyanov, N.B, Mujeeb, A, Du, Z, Tonelli, M, Parslow, T.G, James, T.L. | Deposit date: | 2006-04-05 | Release date: | 2006-04-25 | Last modified: | 2024-05-29 | Method: | SOLUTION NMR | Cite: | NMR Structure of the Full-length Linear Dimer of Stem-Loop-1 RNA in the HIV-1 Dimer Initiation Site. J.Biol.Chem., 281, 2006
|
|
1R7W
| NMR STRUCTURE OF THE R(GGAGGACAUCCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUCCCU BULGE | Descriptor: | 34-MER | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | Deposit date: | 2003-10-22 | Release date: | 2004-05-25 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,). Biochemistry, 43, 2004
|
|
1R7Z
| NMR STRUCTURE OF THE R(GGAGGACAUUCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUUCCU BULGE | Descriptor: | 34-MER | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | Deposit date: | 2003-10-22 | Release date: | 2004-05-25 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,). Biochemistry, 43, 2004
|
|
2JZX
| PCBP2 KH1-KH2 domains | Descriptor: | Poly(rC)-binding protein 2 | Authors: | Du, Z, Fenn, S, Tjhen, R, James, T. | Deposit date: | 2008-01-21 | Release date: | 2008-08-12 | Last modified: | 2024-05-01 | Method: | SOLUTION NMR | Cite: | Structure of the first and second KH domains of human poly-C binding protein-2 reveals insights into its regulatory mechanisms To be Published
|
|
28SP
| |
28SR
| |