7SKN
 
 | |
7SKP
 | |
7T8I
 | |
1OMH
 | | Conjugative Relaxase TrwC in complex with OriT Dna. Metal-free structure. | | Descriptor: | DNA OLIGONUCLEOTIDE, SULFATE ION, trwC protein | | Authors: | Guasch, A, Lucas, M, Moncalian, G, Cabezas, M, Perez-Luque, R, Gomis-Ruth, F.X, de la Cruz, F, Coll, M. | | Deposit date: | 2003-02-25 | | Release date: | 2003-11-25 | | Last modified: | 2017-10-11 | | Method: | X-RAY DIFFRACTION (1.95 Å) | | Cite: | Recognition and processing of the origin of transfer DNA by conjugative relaxase TrwC.
Nat.Struct.Biol., 10, 2003
|
|
1OSB
 | | Conjugative Relaxase TrwC in complex with OriT Dna. Metal-free structure. | | Descriptor: | Dna oligonucleotide, SULFATE ION, TrwC protein | | Authors: | Guasch, A, Lucas, M, Moncalian, G, Cabezas, M, Perez-Luque, R, Gomis-Ruth, F.X, de la Cruz, F, Coll, M. | | Deposit date: | 2003-03-19 | | Release date: | 2003-11-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.65 Å) | | Cite: | Recognition and processing of the origin of transfer DNA by conjugative relaxase TrwC.
Nat.Struct.Biol., 10, 2003
|
|
4IN9
 | | Structure of karilysin MMP-like catalytic domain in complex with inhibitory tetrapeptide SWFP | | Descriptor: | GLYCEROL, Karilysin protease, POTASSIUM ION, ... | | Authors: | Guevara, T, Ksiazek, M, Skottrup, P.D, Cerda-Costa, N, Trillo-Muyo, S, de Diego, I, Riise, E, Potempa, J, Gomis-Ruth, F.X. | | Deposit date: | 2013-01-04 | | Release date: | 2013-05-15 | | Last modified: | 2023-09-20 | | Method: | X-RAY DIFFRACTION (1.55 Å) | | Cite: | Structure of the catalytic domain of the Tannerella forsythia matrix metallopeptidase karilysin in complex with a tetrapeptidic inhibitor.
Acta Crystallogr.,Sect.F, 69, 2013
|
|
1SAX
 | | Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA | | Descriptor: | 5'-d(CAAAATTACAACTGTAATATCGGAG)-3', 5'-d(GCTCCGATATTACAGTTGTAATTTT)-3', Methicillin resistance regulatory protein mecI, ... | | Authors: | Garcia-Castellanos, R, Mallorqui-Fernandez, G, Marrero, A, Potempa, J, Coll, M, Gomis-Ruth, F.X. | | Deposit date: | 2004-02-09 | | Release date: | 2004-04-27 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | On the transcriptional regulation of methicillin resistance: MecI repressor in complex with its operator
J.Biol.Chem., 279, 2004
|
|
2IWA
 | | Unbound glutaminyl cyclotransferase from Carica papaya. | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, CALCIUM ION, GLUTAMINE CYCLOTRANSFERASE, ... | | Authors: | Guevara, T, Mallorqui-Fernandez, N, Garcia-Castellanos, R, Petersen, G.E, Lauritzen, C, Pedersen, J, Arnau, J, Gomis-Ruth, F.X, Sola, M. | | Deposit date: | 2006-06-27 | | Release date: | 2006-07-04 | | Last modified: | 2020-07-29 | | Method: | X-RAY DIFFRACTION (1.6 Å) | | Cite: | Papaya Glutamine Cyclotransferase Shows a Singular Five-Fold Beta-Propeller Architecture that Suggests a Novel Reaction Mechanism.
Biol.Chem., 387, 2006
|
|
2IYN
 | | The co-factor-induced pre-active conformation in PhoB | | Descriptor: | MAGNESIUM ION, PHOSPHATE REGULON TRANSCRIPTIONAL REGULATORY PROTEIN PHOB | | Authors: | Sola, M, Drew, D.L, Blanco, A.G, Gomis-Ruth, F.X, Coll, M. | | Deposit date: | 2006-07-19 | | Release date: | 2006-08-30 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (2.08 Å) | | Cite: | The Cofactor-Induced Pre-Active Conformation in Phob.
Acta Crystallogr.,Sect.D, 62, 2006
|
|
2IWD
 | | Oxacilloyl-acylated MecR1 extracellular antibiotic-sensor domain. | | Descriptor: | (2R,4S)-5,5-dimethyl-2-[(1R)-1-{[(5-methyl-3-phenyl-1,2-oxazol-4-yl)carbonyl]amino}-2-oxoethyl]-1,3-thiazolidine-4-carb oxylic acid, Methicillin resistance mecR1 protein | | Authors: | Marrero, A, Mallorqui-Fernandez, G, Guevara, T, Garcia-Castellanos, R, Gomis-Ruth, F.X. | | Deposit date: | 2006-06-27 | | Release date: | 2006-07-03 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Unbound and Acylated Structures of the Mecr1 Extracellular Antibiotic-Sensor Domain Provide Insights Into the Signal-Transduction System that Triggers Methicillin Resistance.
J.Mol.Biol., 361, 2006
|
|
2IWB
 | | MecR1 unbound extracellular antibiotic-sensor domain. | | Descriptor: | GLYCEROL, METHICILLIN RESISTANCE MECR1 PROTEIN, NICKEL (II) ION, ... | | Authors: | Marrero, A, Mallorqui-Fernandez, G, Guevara, T, Garcia-Castellanos, R, Gomis-Ruth, F.X. | | Deposit date: | 2006-06-27 | | Release date: | 2006-07-04 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Unbound and Acylated Structures of the Mecr1 Extracellular Antibiotic-Sensor Domain Provide Insights Into the Signal-Transduction System that Triggers Methicillin Resistance.
J.Mol.Biol., 361, 2006
|
|
2IWC
 | | Benzylpenicilloyl-acylated MecR1 extracellular antibiotic-sensor domain. | | Descriptor: | METHICILLIN RESISTANCE MECR1 PROTEIN, OPEN FORM - PENICILLIN G | | Authors: | Marrero, A, Mallorqui-Fernandez, G, Guevara, T, Garcia-Castellanos, R, Gomis-Ruth, F.X. | | Deposit date: | 2006-06-27 | | Release date: | 2006-07-04 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Unbound and Acylated Structures of the Mecr1 Extracellular Antibiotic-Sensor Domain Provide Insights Into the Signal-Transduction System that Triggers Methicillin Resistance.
J.Mol.Biol., 361, 2006
|
|
4QHF
 | | Crystal structure of Methanocaldococcus jannaschii monomeric selecase | | Descriptor: | GLYCEROL, NICKEL (II) ION, Uncharacterized protein MJ1213 | | Authors: | Lopez-pelegrin, M, Cerda-costa, N, Cintas-pedrola, A, Herranz-trillo, F, Bernado, P, Peinado, J.R, Arolas, J.L, Gomis-ruth, F.X. | | Deposit date: | 2014-05-28 | | Release date: | 2014-07-16 | | Last modified: | 2024-04-03 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Multiple stable conformations account for reversible concentration-dependent oligomerization and autoinhibition of a metamorphic metallopeptidase
Angew.Chem.Int.Ed.Engl., 53, 2014
|
|
4QHI
 | | Crystal structure of Methanocaldococcus jannaschii selecase mutant R36W | | Descriptor: | CHLORIDE ION, GLYCEROL, Uncharacterized protein MJ1213, ... | | Authors: | Lopez-pelegrin, M, Cerda-costa, N, Cintas-pedrola, A, Herranz-trillo, F, Bernado, P, Peinado, J.R, Arolas, J.L, Gomis-ruth, F.X. | | Deposit date: | 2014-05-28 | | Release date: | 2014-07-16 | | Last modified: | 2024-04-03 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Multiple stable conformations account for reversible concentration-dependent oligomerization and autoinhibition of a metamorphic metallopeptidase
Angew.Chem.Int.Ed.Engl., 53, 2014
|
|
4QHJ
 | | Crystal structure of Methanocaldococcus jannaschii selecase mutant I100F+H107F | | Descriptor: | ACETATE ION, GLYCEROL, Uncharacterized protein MJ1213, ... | | Authors: | Lopez-pelegrin, M, Cerda-costa, N, Cintas-pedrola, A, Herranz-trillo, F, Bernado, P, Peinado, J.R, Arolas, J.L, Gomis-ruth, F.X. | | Deposit date: | 2014-05-28 | | Release date: | 2014-07-16 | | Last modified: | 2024-04-03 | | Method: | X-RAY DIFFRACTION (1.75 Å) | | Cite: | Multiple stable conformations account for reversible concentration-dependent oligomerization and autoinhibition of a metamorphic metallopeptidase
Angew.Chem.Int.Ed.Engl., 53, 2014
|
|
4QHG
 | | Crystal structure of Methanocaldococcus jannaschii dimeric selecase | | Descriptor: | GLYCEROL, Uncharacterized protein MJ1213, ZINC ION | | Authors: | Lopez-pelegrin, M, Cerda-costa, N, Cintas-pedrola, A, Herranz-trillo, F, Bernado, P, Peinado, J.R, Arolas, J.L, Gomis-ruth, F.X. | | Deposit date: | 2014-05-28 | | Release date: | 2014-07-16 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Multiple stable conformations account for reversible concentration-dependent oligomerization and autoinhibition of a metamorphic metallopeptidase
Angew.Chem.Int.Ed.Engl., 53, 2014
|
|
4QHH
 | | Crystal structure of Methanocaldococcus jannaschii tetrameric selecase | | Descriptor: | GLYCEROL, SODIUM ION, Uncharacterized protein MJ1213, ... | | Authors: | Lopez-pelegrin, M, Cerda-costa, N, Cintas-pedrola, A, Herranz-trillo, F, Bernado, P, Peinado, J.R, Arolas, J.L, Gomis-ruth, F.X. | | Deposit date: | 2014-05-28 | | Release date: | 2014-07-16 | | Last modified: | 2024-04-03 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Multiple stable conformations account for reversible concentration-dependent oligomerization and autoinhibition of a metamorphic metallopeptidase
Angew.Chem.Int.Ed.Engl., 53, 2014
|
|
4RBM
 | | Porphyromonas gingivalis gingipain K (Kgp) catalytic and immunoglobulin superfamily-like domains | | Descriptor: | (3S)-3,7-diaminoheptan-2-one, ACETATE ION, AZIDE ION, ... | | Authors: | de Diego, I, Veillard, F, Sztukowska, M.N, Guevara, T, Potempa, B, Pomowski, A, Huntington, J.A, Potempa, J, Gomis-Ruth, F.X. | | Deposit date: | 2014-09-12 | | Release date: | 2014-10-08 | | Last modified: | 2023-11-15 | | Method: | X-RAY DIFFRACTION (1.75 Å) | | Cite: | Structure and Mechanism of Cysteine Peptidase Gingipain K (Kgp), a Major Virulence Factor of Porphyromonas gingivalis in Periodontitis.
J.Biol.Chem., 289, 2014
|
|
4R3V
 | | Structure of karilysin propeptide and catalytic MMP domain | | Descriptor: | CALCIUM ION, GLYCEROL, Karilysin, ... | | Authors: | Lopez-Pelegrin, M, Ksiazek, M, Karim, A.Y, Guevara, T, Arolas, J.L, Potempa, J, Gomis-Ruth, F.X. | | Deposit date: | 2014-08-18 | | Release date: | 2015-01-07 | | Last modified: | 2023-09-20 | | Method: | X-RAY DIFFRACTION (2.01 Å) | | Cite: | A novel mechanism of latency in matrix metalloproteinases.
J.Biol.Chem., 290, 2015
|
|
4YT9
 | | Crystal structure of Porphyromonas gingivalis peptidylarginine deiminase (PPAD) substrate-unbound. | | Descriptor: | GLYCEROL, Peptidylarginine deiminase, SODIUM ION | | Authors: | Goulas, T, Mizgalska, D, Garcia-Ferrer, I, Kantyka, T, Guevara, T, Szmigielski, B, Sroka, A, Millan, C, Uson, I, Veillard, F, Potempa, B, Mydel, P, Sola, M, Potempa, J, Gomis-Ruth, F.X. | | Deposit date: | 2015-03-17 | | Release date: | 2015-07-15 | | Method: | X-RAY DIFFRACTION (1.5 Å) | | Cite: | Structure and mechanism of a bacterial host-protein citrullinating virulence factor, Porphyromonas gingivalis peptidylarginine deiminase.
Sci Rep, 5, 2015
|
|
4YTB
 | | Crystal structure of Porphyromonas gingivalis peptidylarginine deiminase (PPAD) in complex with dipeptide Asp-Gln. | | Descriptor: | ASPARTIC ACID, AZIDE ION, CHLORIDE ION, ... | | Authors: | Goulas, T, Mizgalska, D, Garcia-Ferrer, I, Kantyka, T, Guevara, T, Szmigielski, B, Sroka, A, Millan, C, Uson, I, Veillard, F, Potempa, B, Mydel, P, Sola, M, Potempa, J, Gomis-Ruth, F.X. | | Deposit date: | 2015-03-17 | | Release date: | 2015-07-01 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (1.4 Å) | | Cite: | Structure and mechanism of a bacterial host-protein citrullinating virulence factor, Porphyromonas gingivalis peptidylarginine deiminase.
Sci Rep, 5, 2015
|
|
4YU5
 | | Crystal structure of selenomethionine variant of Bacillus anthracis immune inhibitor A2 peptidase zymogen | | Descriptor: | 3-(1-methylpiperidinium-1-yl)propane-1-sulfonate, CALCIUM ION, GLYCEROL, ... | | Authors: | Arolas, J.L, Goulas, T, Gomis-Ruth, F.X. | | Deposit date: | 2015-03-18 | | Release date: | 2015-10-28 | | Last modified: | 2016-01-20 | | Method: | X-RAY DIFFRACTION (2.9 Å) | | Cite: | Structural Basis for Latency and Function of Immune Inhibitor A Metallopeptidase, a Modulator of the Bacillus anthracis Secretome.
Structure, 24, 2016
|
|
4YTG
 | | Crystal structure of Porphyromonas gingivalis peptidylarginine deiminase (PPAD) mutant C351A in complex with dipeptide Met-Arg. | | Descriptor: | ARGININE, AZIDE ION, CHLORIDE ION, ... | | Authors: | Goulas, T, Mizgalska, D, Garcia-Ferrer, I, Kantyka, T, Guevara, T, Szmigielski, B, Sroka, A, Millan, C, Uson, I, Veillard, F, Potempa, B, Mydel, P, Sola, M, Potempa, J, Gomis-Ruth, F.X. | | Deposit date: | 2015-03-17 | | Release date: | 2015-07-01 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Structure and mechanism of a bacterial host-protein citrullinating virulence factor, Porphyromonas gingivalis peptidylarginine deiminase.
Sci Rep, 5, 2015
|
|
4YU6
 | | Crystal structure of Bacillus anthracis immune inhibitor A2 peptidase zymogen | | Descriptor: | ACETONITRILE, CALCIUM ION, Immune inhibitor A, ... | | Authors: | Arolas, J.L, Goulas, T, Gomis-Ruth, F.X. | | Deposit date: | 2015-03-18 | | Release date: | 2015-10-28 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Structural Basis for Latency and Function of Immune Inhibitor A Metallopeptidase, a Modulator of the Bacillus anthracis Secretome.
Structure, 24, 2016
|
|
5AG8
 | | CRYSTAL STRUCTURE OF A MUTANT (665I6H) OF THE C-TERMINAL DOMAIN OF RGPB | | Descriptor: | GINGIPAIN R2, GLYCEROL, SULFATE ION | | Authors: | de Diego, I, Ksiazek, M, Mizgalska, D, Golik, P, Szmigielski, B, Nowak, M, Nowakowska, Z, Potempa, B, Koneru, L, Nguyen, K.A, Enghild, J, Thogersen, I.B, Dubin, G, Gomis-Ruth, F.X, Potempa, J. | | Deposit date: | 2015-01-29 | | Release date: | 2016-04-06 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | The Outer-Membrane Export Signal of Porphyromonas Gingivalis Type Ix Secretion System (T9Ss) is a Conserved C-Terminal Beta-Sandwich Domain.
Sci.Rep., 6, 2016
|
|
