1SAX

Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA

Summary for 1SAX

Entry DOI	10.2210/pdb1sax/pdb
Related	1OKR
Descriptor	5'-d(GCTCCGATATTACAGTTGTAATTTT)-3', 5'-d(CAAAATTACAACTGTAATATCGGAG)-3', Methicillin resistance regulatory protein mecI, ... (5 entities in total)
Functional Keywords	winged helix-turn-helix, transcription-dna complex, transcription/dna
Biological source	Staphylococcus aureus subsp. aureus
Cellular location	Cytoplasm (Probable): P68262
Total number of polymer chains	4
Total formula weight	45016.08
Authors	Garcia-Castellanos, R.,Mallorqui-Fernandez, G.,Marrero, A.,Potempa, J.,Coll, M.,Gomis-Ruth, F.X. (deposition date: 2004-02-09, release date: 2004-04-27, Last modification date: 2023-08-23)
Primary citation	Garcia-Castellanos, R.,Mallorqui-Fernandez, G.,Marrero, A.,Potempa, J.,Coll, M.,Gomis-Ruth, F.X. On the transcriptional regulation of methicillin resistance: MecI repressor in complex with its operator J.Biol.Chem., 279:17888-17896, 2004 Cited by PubMed: 14960592 DOI: 10.1074/jbc.M313123200 PDB entries with the same primary citation
Experimental method	X-RAY DIFFRACTION (2.8 Å)

Structure validation