6W3Q
APE1 exonuclease substrate complex L104R
Entity
| Entity ID | Chain ID | Description | Type | Chain length | Formula weight | Number of molecules | DB Name (Accession) | Biological source | Descriptive keywords |
| 1 | C | TCGACGGATCC | polymer | 11 | 3334.2 | 1 | synthetic construct | ||
| 2 | D | GCTGATGCG(C7R) | polymer | 10 | 3077.1 | 1 | synthetic construct | ||
| 3 | E | GGATCCGTCGATCGCATCAGC | polymer | 21 | 6424.1 | 1 | synthetic construct | ||
| 4 | A, B | DNA-(apurinic or apyrimidinic site) lyase | polymer | 276 | 31232.6 | 2 | UniProt (P27695) Pfam (PF03372) In PDB | Homo sapiens (Human) | APEX nuclease,APEN,Apurinic-apyrimidinic endonuclease 1,APE-1,REF-1,Redox factor-1 |
| 5 | C | SODIUM ION | non-polymer | 23.0 | 1 | Chemie (NA) | |||
| 6 | D | CALCIUM ION | non-polymer | 40.1 | 1 | Chemie (CA) | |||
| 7 | water | water | 18.0 | 27 | Chemie (HOH) |
Sequence modifications
A, B: 43 - 318 (UniProt: P27695)
| PDB | External Database | Details |
|---|---|---|
| Arg 104 | Leu 104 | engineered mutation |
Sequence viewer
Contents of the asymmetric unit
| Polymers | Number of chains | 5 |
| Total formula weight | 75300.6 | |
| Non-Polymers* | Number of molecules | 2 |
| Total formula weight | 63.1 | |
| All* | Total formula weight | 75363.6 |
