6W3N
APE1 exonuclease substrate complex D148E
Entity
| Entity ID | Chain ID | Description | Type | Chain length | Formula weight | Number of molecules | DB Name (Accession) | Biological source | Descriptive keywords |
| 1 | C | TCGACGGATCC | polymer | 11 | 3334.2 | 1 | synthetic construct | ||
| 2 | D | DNA (5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*(C7R))-3') | polymer | 10 | 3077.1 | 1 | synthetic construct | ||
| 3 | E | GGATCCGTCGATCGCATCAGC | polymer | 21 | 6424.1 | 1 | synthetic construct | ||
| 4 | A, B | DNA-(apurinic or apyrimidinic site) lyase | polymer | 276 | 31202.6 | 2 | UniProt (P27695) Pfam (PF03372) In PDB | Homo sapiens (Human) | APEX nuclease,APEN,Apurinic-apyrimidinic endonuclease 1,APE-1,REF-1,Redox factor-1 |
| 5 | D | CALCIUM ION | non-polymer | 40.1 | 1 | Chemie (CA) | |||
| 6 | A | 1,2-ETHANEDIOL | non-polymer | 62.1 | 1 | Chemie (EDO) | |||
| 7 | water | water | 18.0 | 42 | Chemie (HOH) |
Sequence modifications
A, B: 43 - 318 (UniProt: P27695)
| PDB | External Database | Details |
|---|---|---|
| Glu 148 | Asp 148 | engineered mutation |
Sequence viewer
Contents of the asymmetric unit
| Polymers | Number of chains | 5 |
| Total formula weight | 75240.5 | |
| Non-Polymers* | Number of molecules | 2 |
| Total formula weight | 102.1 | |
| All* | Total formula weight | 75342.7 |
