| PDBID: | 9yzu | | Status: | HPUB -- hold until publication | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence ATGAGTCATA and loaded with mutated Bzip region of GCN4 transcription factor | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzs | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with Even-skipped homeodomain | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzt | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with Antennapedia homeodomain | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzr | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with ultrabithorax homeodomain | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzg | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence ATGAGTCATA | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzk | | Status: | HPUB -- hold until publication | | Title: | Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9z01 | | Status: | HPUB -- hold until publication | | Title: | Crystal structure of a large RuBisCO from Promethearchaeum syntrophicum | | Authors: | Pereira, J.H., Kehl, A.J., Shih, P.M., Adams, P.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9xfs | | Status: | HPUB -- hold until publication | | Title: | Structure of glutamine amidotransferase DnfC from Alcaligenes sp. | | Authors: | Qin, Y.L., Guo, L., Wang, X.K., Li, D.F. | | Deposition date: | 2025-10-29 |
|
| PDBID: | 9yyu | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | VN01H1 Fab-bound SARS-CoV-2 E-FIC structure (membrane proximal region) | | Authors: | Park, Y.J., Veesler, D., Seattle Structural Genomics Center for Infectious Disease (SSGCID) | | Deposition date: | 2025-10-29 |
|
| PDBID: | 9yyv | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | VN01H1 Fab-bound SARS-CoV-2 E-FIC structure (membrane distal region) | | Authors: | Park, Y.J., Seattle Structural Genomics Center for Infectious Disease (SSGCID), Veesler, D. | | Deposition date: | 2025-10-29 |
|
| PDBID: | 9xee | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Crystal Structure of Beta vulgaris (Sugar beet) DJ-1D Protein | | Authors: | MacCarthy, C., Bulgakov, N., Petrova, D., Shevtsov, M.Y., Zharkov, D., Borshchevskiy, V. | | Deposition date: | 2025-10-28 |
|
| PDBID: | 9t3m | | Status: | HPUB -- hold until publication | | Title: | Crystal Structure of 11 bound to the PH domain of Btk | | Authors: | Brear, P., West, R.M., Nicolescu, R.C.B., Blaszczyk, B.K., Deingruber, T., Sanders, M.G., Perez-Areales, F.J., Spring, D.R., Hyvonen, M. | | Deposition date: | 2025-10-28 |
|
| PDBID: | 9yy5 | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Crystal structure of P. furiosus SRP54 NG domain G225E | | Authors: | Yang, M., Bruner, S.D. | | Deposition date: | 2025-10-28 |
|
| PDBID: | 9yy0 | | Status: | HPUB -- hold until publication | | Title: | IGHV4-34 germline-reverted antibody pre166 | | Authors: | Langley, D.B., Christ, D. | | Deposition date: | 2025-10-28 |
|
| PDBID: | 9t3c | | Status: | HPUB -- hold until publication | | Title: | RACB with GDT bound | | Authors: | Janowski, R., Mohamadi, M., Hagn, F., Niessing, D. | | Deposition date: | 2025-10-27 |
|
| PDBID: | 9t3d | | Status: | HPUB -- hold until publication | | Title: | RACB with GPPNHP bound | | Authors: | Janowski, R., Mohamadi, M., Hagn, F., Niessing, D. | | Deposition date: | 2025-10-27 |
|
| PDBID: | 9t3e | | Status: | HPUB -- hold until publication | | Title: | RACB with GSP and the fragment of RIPb protein bound (antiparallel) | | Authors: | Janowski, R., Mohamadi, M., Hagn, F., Niessing, D. | | Deposition date: | 2025-10-27 |
|
| PDBID: | 9t3f | | Status: | HPUB -- hold until publication | | Title: | RACB with GSP and the fragment of RIPb protein bound (parallel) | | Authors: | Janowski, R., Mohamadi, M., Hagn, F., Niessing, D. | | Deposition date: | 2025-10-27 |
|
| PDBID: | 9t3g | | Status: | HPUB -- hold until publication | | Title: | Crystal Structure of 12 bound to the PH domain of Btk | | Authors: | Brear, P., West, R.M., Nicolescu, R.C.B., Blaszczyk, B.K., Deingruber, T., Sanders, M.G., Perez-Areales, F.J., Spring, D.R., Hyvonen, M. | | Deposition date: | 2025-10-27 |
|
| PDBID: | 9yxo | | Status: | REPL -- author sent new coordinates, entry to be reprocessed | | Title: | Human Stimulator of Interferon Genes Complex | | Authors: | Fernandez, D., Li, L., Cao, X. | | Deposition date: | 2025-10-27 |
|
| PDBID: | 9yxz | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Cryo-EM structure of HIV-1 Env trimer BG505 SOSIP.664 in complex with N12-i2 Fab and sCD4 conformational state II | | Authors: | Chandravanshi, M., Tolbert, W.D., Pazgier, M. | | Deposition date: | 2025-10-27 |
|
| PDBID: | 9yw7 | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Cryo-EM structure of HIV-1 Env trimer BG505 SOSIP.664 in complex with N12-i2 Fab and sCD4 conformational state I | | Authors: | Chandravanshi, M., Tolbert, W.D., Pazgier, M. | | Deposition date: | 2025-10-24 |
|
| PDBID: | 9xc3 | | Status: | HPUB -- hold until publication | | Title: | complex of TCR1414_1-TGFbetaR2(-1)-HLA-DR4, a TGFbetaR2(-1)-HLA-DR4,with a TGFbetaR2(-1) specific TCRl414_1 | | Authors: | Shi, J.L., Wu, D.C. | | Deposition date: | 2025-10-24 |
|
| PDBID: | 9yuy | | Status: | HPUB -- hold until publication | | Title: | Structure of the Plasmodium falciparum 20S proteasome in complex with a beta5-selective covalent syringolin analogue inhibitor. | | Authors: | Yan, N.L., Gu, X., Fajtova, P., Tse, E., Melo, A., Southworth, D.R., O''Donoghue, A., Sello, J.K., Gestwicki, J.E. | | Deposition date: | 2025-10-23 |
|
| PDBID: | 9yw4 | | Status: | HOLD -- hold until a certain date | | Title: | T cell receptor N17.2 complexed w/ HLA.A1 and NRAS peptide | | Authors: | Gallagher, D.T., Mariuzza, R.A. | | Deposition date: | 2025-10-23 | | Release date: | 2026-10-23 |
|
