| PDBID: | 9yzm | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CTAATTAGGC and loaded with Even-skipped homeodomain | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzn | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with Even-skipped homeodomain | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzo | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with Even-skipped homeodomain | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzp | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with ultrabithorax homeodomain | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzq | | Status: | HPUB -- hold until publication | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with Engrailed homeodomain enhanced Green fluorescent protein fusion | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yze | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzj | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CGTAATTAGG | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzu | | Status: | HPUB -- hold until publication | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence ATGAGTCATA and loaded with mutated Bzip region of GCN4 transcription factor | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzs | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with Even-skipped homeodomain | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzt | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with Antennapedia homeodomain | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzr | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with ultrabithorax homeodomain | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzg | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence ATGAGTCATA | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzk | | Status: | HPUB -- hold until publication | | Title: | Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9z01 | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Crystal structure of a large RuBisCO from Promethearchaeum syntrophicum | | Authors: | Pereira, J.H., Kehl, A.J., Shih, P.M., Adams, P.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9yzi | | Status: | PROC -- to be processed | | Title: | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA | | Authors: | Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | | Deposition date: | 2025-10-30 |
|
| PDBID: | 9xfs | | Status: | HPUB -- hold until publication | | Title: | Structure of glutamine amidotransferase DnfC from Alcaligenes sp. | | Authors: | Qin, Y.L., Guo, L., Wang, X.K., Li, D.F. | | Deposition date: | 2025-10-29 |
|
| PDBID: | 9yyu | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | VN01H1 Fab-bound SARS-CoV-2 E-FIC structure (membrane proximal region) | | Authors: | Park, Y.J., Veesler, D., Seattle Structural Genomics Center for Infectious Disease (SSGCID) | | Deposition date: | 2025-10-29 |
|
| PDBID: | 9yyv | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | VN01H1 Fab-bound SARS-CoV-2 E-FIC structure (membrane distal region) | | Authors: | Park, Y.J., Seattle Structural Genomics Center for Infectious Disease (SSGCID), Veesler, D. | | Deposition date: | 2025-10-29 |
|
| PDBID: | 9xee | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Crystal Structure of Beta vulgaris (Sugar beet) DJ-1D Protein | | Authors: | MacCarthy, C., Bulgakov, N., Petrova, D., Shevtsov, M.Y., Zharkov, D., Borshchevskiy, V. | | Deposition date: | 2025-10-28 |
|
| PDBID: | 9t3m | | Status: | HPUB -- hold until publication | | Title: | Crystal Structure of 11 bound to the PH domain of Btk | | Authors: | Brear, P., West, R.M., Nicolescu, R.C.B., Blaszczyk, B.K., Deingruber, T., Sanders, M.G., Perez-Areales, F.J., Spring, D.R., Hyvonen, M. | | Deposition date: | 2025-10-28 |
|
| PDBID: | 9yy5 | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Crystal structure of P. furiosus SRP54 NG domain G225E | | Authors: | Yang, M., Bruner, S.D. | | Deposition date: | 2025-10-28 |
|
| PDBID: | 9yy0 | | Status: | HPUB -- hold until publication | | Title: | IGHV4-34 germline-reverted antibody pre166 | | Authors: | Langley, D.B., Christ, D. | | Deposition date: | 2025-10-28 |
|
| PDBID: | 9t3g | | Status: | HPUB -- hold until publication | | Title: | Crystal Structure of 12 bound to the PH domain of Btk | | Authors: | Brear, P., West, R.M., Nicolescu, R.C.B., Blaszczyk, B.K., Deingruber, T., Sanders, M.G., Perez-Areales, F.J., Spring, D.R., Hyvonen, M. | | Deposition date: | 2025-10-27 |
|
| PDBID: | 9t3c | | Status: | HPUB -- hold until publication | | Title: | RACB with GDT bound | | Authors: | Janowski, R., Mohamadi, M., Hagn, F., Niessing, D. | | Deposition date: | 2025-10-27 |
|
| PDBID: | 9t3d | | Status: | HPUB -- hold until publication | | Title: | RACB with GPPNHP bound | | Authors: | Janowski, R., Mohamadi, M., Hagn, F., Niessing, D. | | Deposition date: | 2025-10-27 |
|
