| PDBID: | 9jhg | | Status: | HPUB -- hold until publication | | Title: | Cryo-em structure of beta-LG fibril | | Authors: | Xu, Y.Y., Liu, C. | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9jh4 | | Status: | AUTH -- processed, waiting for author review and approval | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9jhh | | Status: | HPUB -- hold until publication | | Title: | Cryo-em structure of beta-LG fibril | | Authors: | Xu, Y.Y., Liu, C. | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9jhi | | Status: | HPUB -- hold until publication | | Title: | Cryo-em structure of beta-LG fibril | | Authors: | Xu, Y.Y., Liu, C. | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9jhc | | Status: | HPUB -- hold until publication | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9jhb | | Status: | HPUB -- hold until publication | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9jhd | | Status: | HPUB -- hold until publication | | Deposition date: | 2024-09-09 | | Sequence: | >Entity 1
TAIANRYEFVLLFDVENGNPNGDPDAGNMPRIDPETGHGLVTDVCLKRKIRNHVALTKEGAERFNIYIQEKAILNETHERAYTACDLKPEPKKLPKKVEDAKRVTDWMCTNFYDIRTFGAVMTTEVNCGQVRGPVQMAFARSVEPVVPQEVSITRMAVTTKAEAEKQQGDNRTMGRKHIVPYGLYVAHGFISAPLAEKTGFSDEDLTLFWDALVNMFEHDRSAARGLMSSRKLIVFKHQNRLGNAPAHKLFDLVKVSRAEGSSGPARSFADYAVTVGQAPEGVEVKEML
>Entity 2
SLDPARTDRPYLLGRLFAVLEKAQEDAVPGANATIKDRYLASASANPGQVFHMLLKNASNHTAKLRKDPERKGSAIHYEIMMQEIIDNISDFPVTMSSDEQGLFMIGYYHQRKALF
>Entity 3
UGGAUCGAAACACGACCUCGAGUCUGGUAAAGAAACCGCUGCUGCGAAAUUUGAACGCCAGCACAUGGACUCGUCUACUAGCGCAGCUUAAUUAACCUAGGCUGCUGCCACCGCUGAGCAAUAA
|
|
| PDBID: | 9jha | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | X-ray structure of the Haloalkane dehalogenase HaloTag7 labeled with BD626-HTL substrate | | Authors: | Zhixing, C., Kecheng, Z. | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9jhe | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | 3-hydroxybutyryl-CoA dehydrogenase | | Authors: | Park, J.A., Yang, J.W., Park, S.H., Kim, S.H., Hwang, K.Y. | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9jhj | | Status: | PROC -- to be processed | | Title: | Cryo-EM structure of the C20:0 fatty acid-bound FPR2-Gi complex | | Authors: | Sun, J.P., Jiang, C.T., Kong, W., Yu, X., Cai, K., Guo, L.L. | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9jh6 | | Status: | PROC -- to be processed | | Title: | Activation mechanism of CYSLTR2 by C20:0 | | Authors: | Wang, J.L., Sun, J.P., Yu, X. | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9dkp | | Status: | HPUB -- hold until publication | | Title: | The structure of human vacuolar protein sorting 34 catalytic domain bound to RD-I-53 | | Authors: | Abiodun, W.O., Tsubaki, E., Dass, R., Singleton, J.D., Samarawickrama, P., Doukov, T., Peterson, M.A., Moody, J.D. | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9dkt | | Status: | AUTH -- processed, waiting for author review and approval | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9dko | | Status: | AUTH -- processed, waiting for author review and approval | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9dki | | Status: | PROC -- to be processed | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9dkl | | Status: | HPUB -- hold until publication | | Title: | Ca2+ bound aplysia Slo1 F304A | | Authors: | Gustavo, G.F., Shen, R., Latorre, R., Perozo, E. | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9dkk | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Designed miniproteins potently inhibit and protect against MERS-CoV. MERS-CoV S in complex with miniprotein cb3_GGGSGGGS_SB175, linker 7 (Local refinement of two RBDs and 2 miniproteins) | | Authors: | Tortorici, M.A., Veesler, D., Seattle Structural Genomics Center for Infectious Disease (SSGCID) | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9dkn | | Status: | HPUB -- hold until publication | | Title: | Apo aplysia Slo1 R202Q | | Authors: | Gustavo, G.F., Shen, R., Latorre, R., Perozo, E. | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9dkr | | Status: | AUTH -- processed, waiting for author review and approval | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9dks | | Status: | AUTH -- processed, waiting for author review and approval | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9dkj | | Status: | AUTH -- processed, waiting for author review and approval | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9dkm | | Status: | AUTH -- processed, waiting for author review and approval | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9dkq | | Status: | AUTH -- processed, waiting for author review and approval | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9jgr | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Crystal structure of SARS-Cov-2 main protease in complex with Ibuzatrelvir | | Authors: | Zhou, X.L., Zhang, J., Li, J. | | Deposition date: | 2024-09-08 | | Release date: | 2025-09-08 |
|
| PDBID: | 9jgs | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Crystal structure of SARS main protease in complex with Ibuzatrelvir | | Authors: | Jiang, H.H., Zhang, J., Li, J. | | Deposition date: | 2024-09-08 | | Release date: | 2025-09-08 |
|
