PDBInfo pagesStatus search: 1801 resultsChemie searchBIRD

PDBID: 9yzt Status: PROC -- to be processed Title: Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with Antennapedia homeodomain Authors: Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. Deposition date: 2025-10-30

PDBID: 9yzr Status: PROC -- to be processed Title: Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with ultrabithorax homeodomain Authors: Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. Deposition date: 2025-10-30

PDBID: 9yzg Status: PROC -- to be processed Title: Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence ATGAGTCATA Authors: Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. Deposition date: 2025-10-30

PDBID: 9yzk Status: PROC -- to be processed Title: Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA Authors: Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. Deposition date: 2025-10-30

PDBID: 9yzz Status: PROC -- to be processed Title: Crystal structure of Trastuzumab Fab conjugated to Linker-Payload Authors: Jaime-Garza, M., Noland, C.L., Gabelli, S.B. Deposition date: 2025-10-30

PDBID: 9xee Status: PROC -- to be processed Title: Crystal Structure of Beta vulgaris (Sugar beet) DJ-1D Protein Authors: MacCarthy, C., Shevtsov, M.Y., Petrova, D., Bulgakov, N., Borshchevskiy, V., Zharkov, D. Deposition date: 2025-10-28

PDBID: 9xf6 Status: PROC -- to be processed Title: Bacterial IgM-degrading enzyme Authors: Chen, C., Zhang, K. Deposition date: 2025-10-28

PDBID: 9t3m Status: HPUB -- hold until publication Title: Crystal Structure of 11 bound to the PH domain of Btk Authors: Brear, P., West, R.M., Nicolescu, R.C.B., Blaszczyk, B.K., Deingruber, T., Sanders, M.G., Perez-Areales, F.J., Spring, D.R., Hyvonen, M. Deposition date: 2025-10-28

PDBID: 9t3q Status: HPUB -- hold until publication Title: Crystal structure of D1228V c-MET bound by cabozantinib. Authors: Collie, G.W., Russell, I.C. Deposition date: 2025-10-28

PDBID: 9xdc Status: PROC -- to be processed Title: TamAB hybrid barrel state Authors: Dong, C., Zhang, Z., Yang, B. Deposition date: 2025-10-27

PDBID: 9yxj Status: AUTH -- processed, waiting for author review and approval Title: GluA2 flip-Q isoform in complex with TARP gamma2(KKEE) mutant, co-expressed without tether, TR-CEM, sprayed with agonist, (C3-m, LBD B/C) Authors: Nakagawa, T., Ivica, J., Greger, I. Deposition date: 2025-10-27

PDBID: 9t3g Status: AUTH -- processed, waiting for author review and approval Title: Crystal Structure of 12 bound to the PH domain of Btk Authors: Brear, P., West, R.M., Nicolescu, R.C.B., Blaszczyk, B.K., Deingruber, T., Sanders, M.G., Perez-Areales, F.J., Spring, D.R., Hyvonen, M. Deposition date: 2025-10-27

PDBID: 9yx3 Status: PROC -- to be processed Title: Duck hepatitis B virus nucleocapsid Authors: Gibes, N.G., Wang, J.C.-Y., Hu, J., Zlotnick, A. Deposition date: 2025-10-26

PDBID: 9yx7 Status: HPUB -- hold until publication Title: Local refinement of BA.3.2 spike (3-RBD-down), RBD-A and NTD-C Authors: Wang, Y., Hu, Y., Chen, Z., Liang, B., Xie, X. Deposition date: 2025-10-26

PDBID: 9yx8 Status: HPUB -- hold until publication Title: Local refinement of BA.3.2 spike (3-RBD-down), RBD-A, RBD-C and NTD-B Authors: Wang, Y., Hu, Y., Chen, Z., Liang, B., Xie, X. Deposition date: 2025-10-26

PDBID: 9yx9 Status: PROC -- to be processed Title: SARS-CoV-2 SL5 rotated junction Authors: Kretsch, R.C., Xu, L., Chiu, W., Das, R. Deposition date: 2025-10-26

PDBID: 9yxa Status: PROC -- to be processed Title: BtCoV SL5 with SL5c truncated Authors: Kretsch, R.C., Xu, L., Chiu, W., Das, R. Deposition date: 2025-10-26

PDBID: 9xc8 Status: AUTH -- processed, waiting for author review and approval Title: Crystal structure of Bacteroides uniformis O-acetyltransferase Authors: Meng, C.Y., Jian, X., Wu, B.X. Deposition date: 2025-10-25

PDBID: 9xbj Status: PROC -- to be processed Title: Cryo-EM structure of Arabidopsis KJC2 in dodecamer state Authors: Zhang, C., Chen, X., Liu, L. Deposition date: 2025-10-24

PDBID: 9xbh Status: PROC -- to be processed Title: Crystal structure of E19A mutant chitosanase from Bacillus subtilis MY002 complexed with GlcNs. Authors: Xie, J., Liu, Z.C., Wang, G.G. Deposition date: 2025-10-24 Release date: 2026-10-24

PDBID: 9xc3 Status: PROC -- to be processed Title: complex of TCR1414_1-TGFbetaR2(-1)-HLA-DR4, a TGFbetaR2(-1)-HLA-DR4,with a TGFbetaR2(-1) specific TCRl414_1 Authors: Shi, J.L., Wu, D.C. Deposition date: 2025-10-24

PDBID: 9ywg Status: PROC -- to be processed Title: Structure of mouse TRPV3 (412S), heated to 42 C by DSC Authors: Mugo, A.N., Qin, F. Deposition date: 2025-10-24

PDBID: 9ywc Status: AUTH -- processed, waiting for author review and approval Title: CryoEM structure of hSAMD9L state2 Authors: Sekiguchi, Y., Kalathur, R.C. Deposition date: 2025-10-24

PDBID: 9ywo Status: AUTH -- processed, waiting for author review and approval Title: CryoEM structure of truncated hSAMD9L state1 Authors: Sekiguchi, Y., Kalathur, R.C. Deposition date: 2025-10-24

PDBID: 9ywr Status: AUTH -- processed, waiting for author review and approval Title: CryoEM structure of truncated hSAMD9L state2 Authors: Sekiguchi, Y., Kalathur, R.C. Deposition date: 2025-10-24

<12345678910111213141516>