Loading
PDBj
MenuPDBj@FacebookPDBj@TwitterPDBj@YouTubewwPDB FoundationwwPDB
RCSB PDBPDBeBMRBAdv. SearchSearch help
Status search: 13156 results
PDBID:9j9q
Status:HOLD -- hold until a certain date
Title:artificial mononuclear Cu-bound metalloprotein 6 (M6:Cu)
Authors:Jeong, W.J., Song, W.J.
Deposition date:2024-08-23
Release date:2025-08-23
PDBID:9j9r
Status:HOLD -- hold until a certain date
Title:artificial mononuclear Zn-bound metalloprotein 6 (M6:Zn)
Authors:Jeong, W.J., Song, W.J.
Deposition date:2024-08-23
Release date:2025-08-23
PDBID:9j9x
Status:HOLD -- hold until a certain date
Title:Tetrahymena Ribozyme L-16 complex with small molecule inhibitor ZP-Tth70
Authors:Pan, Z.L., Hu, H., Su, Z.M.
Deposition date:2024-08-23
Release date:2025-08-23
Sequence:

>Entity 1


GAAAAGUUAUCAGGCAUGCACCUGGUAGCUAGUCUUUAAACCAAUAGAUUGCAUCGGUUUAAAAGGCAAGACCGUCAAAUUGCGGGAAAGGGGUCAACAGCCGUUCAGUACCAAGUCUCAGGGGAAACUUUGAGAUGGCCUUGCAAAGGGUAUGGUAAUAAGCUGACGGACAUGGUCCUAACCACGCAGCCAAGUCCUAAGUCAACAGAUCUUCUGUUGAUAUGGAUGCAGUUCACAGACUAAAUGUCGGUCGGGGAAGAUGUAUUCUUCUCAUAAGAUAUAGUCGGACCUCUCCUUAAUGGGAGCUAGCGGAUGAAGUGAUGCAACACUGGAGCCGCUGGGAACUAAUUUGUAUGCGAAAGUAUAUUGAUUAGUUUUGGAG
PDBID:9j9s
Status:HOLD -- hold until a certain date
Title:artificial mononuclear Zn-bound metalloprotein 5 (M5:Zn)
Authors:Jeong, W.J., Song, W.J.
Deposition date:2024-08-23
Release date:2025-08-23
PDBID:9j9t
Status:HOLD -- hold until a certain date
Title:artificial mononuclear Zn-bound metalloprotein 4 (M4:Zn)
Authors:Jeong, W.J., Song, W.J.
Deposition date:2024-08-23
Release date:2025-08-23
PDBID:9j9u
Status:AUTH -- processed, waiting for author review and approval
Title:artificial dinuclear Mn-bound metalloprotein 2 (D2:Mn)
Authors:Jeong, W.J., Song, W.J.
Deposition date:2024-08-23
Release date:2025-08-23
PDBID:9ja2
Status:AUTH -- processed, waiting for author review and approval
Deposition date:2024-08-23
PDBID:9j9v
Status:HOLD -- hold until a certain date
Title:artificial dinuclear Fe-bound metalloprotein 2 (D2:Fe)
Authors:Jeong, W.J., Song, W.J.
Deposition date:2024-08-23
Release date:2025-08-23
PDBID:9j9z
Status:REPL -- author sent new coordinates, entry to be reprocessed
Title:Cryo-EM structure of Outward state Anhydromuropeptide permease (AmpG) complex with GlcNAc-1,6-anhMurNAc
Authors:Chang, N., Kim, U., Cho, H.
Deposition date:2024-08-23
PDBID:9db6
Status:AUTH -- processed, waiting for author review and approval
Title:Sialidase682 co-crystallized with inhibitor DANA
Authors:Young, M.A., Rees, S.D., Chang, G.
Deposition date:2024-08-23
PDBID:9db8
Status:AUTH -- processed, waiting for author review and approval
Title:Cu-Bound Structure of Computationally Designed Homotrimer Tet4
Authors:Hoffnagle, A.M., Tezcan, F.A.
Deposition date:2024-08-23
PDBID:9db5
Status:AUTH -- processed, waiting for author review and approval
Title:A DARPin fused to the 1TEL crystallization chaperone via a proline-alanine linker
Authors:Pedroza Romo, M.J., Averett, J.C., Keliiliki, A., Wilson, E.W., Smith, C., Hansen, D., Averett, B., Gonzalez, J., Noakes, E., Nickles, R., Doukov, T., Moody, J.D.
Deposition date:2024-08-23
PDBID:9db9
Status:AUTH -- processed, waiting for author review and approval
Title:Ni-Bound Structure of Computationally Designed Homotrimer Tet4
Authors:Hoffnagle, A.M., Tezcan, F.A.
Deposition date:2024-08-23
PDBID:9dba
Status:AUTH -- processed, waiting for author review and approval
Title:Co-Bound Structure of Computationally Designed Homotrimer Tet4
Authors:Hoffnagle, A.M., Tezcan, F.A.
Deposition date:2024-08-23
PDBID:9dbb
Status:AUTH -- processed, waiting for author review and approval
Title:Fe-Bound Structure of Computationally Designed Homotrimer Tet4
Authors:Hoffnagle, A.M., Tezcan, F.A.
Deposition date:2024-08-23
PDBID:9db2
Status:HPUB -- hold until publication
Deposition date:2024-08-23
PDBID:9daz
Status:AUTH -- processed, waiting for author review and approval
Title:Molecular basis of pathogenicity of the recently emerged FCoV-23 coronavirus. Complex of fAPN with FCoV-23 RBD
Authors:Tortorici, M.A., Veesler, D., Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Deposition date:2024-08-23
PDBID:9db0
Status:AUTH -- processed, waiting for author review and approval
Title:Molecular basis of pathogenicity of the recently emerged FCoV-23 coronavirus. FCoV-23 S short
Authors:Tortorici, M.A., Veesler, D., Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Deposition date:2024-08-23
PDBID:9db1
Status:AUTH -- processed, waiting for author review and approval
Title:Molecular basis of pathogenicity of the recently emerged FCoV-23 coronavirus. FCoV-23 S Do in proximal conformation (local refinement)
Authors:Tortorici, M.A., Veesler, D., Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Deposition date:2024-08-23
PDBID:9db3
Status:AUTH -- processed, waiting for author review and approval
Title:Molecular basis of pathogenicity of the recently emerged FCoV-23 coronavirus. FCoV-23 S long with Do in swung-out conformation
Authors:Tortorici, M.A., Veesler, D.
Deposition date:2024-08-23
PDBID:9db7
Status:AUTH -- processed, waiting for author review and approval
Title:Crystal structure of NDM-1 complexed with compound 21
Authors:Jacobs, L.M.C., Chen, Y.
Deposition date:2024-08-23
PDBID:9db4
Status:AUTH -- processed, waiting for author review and approval
Title:Binary complex of DNA polymerase iota with DNA (template A)
Authors:Frevert, Z., Reusch, D., Freudenthal, B.
Deposition date:2024-08-23
PDBID:9dbo
Status:AUTH -- processed, waiting for author review and approval
Deposition date:2024-08-23
Release date:2025-08-23
PDBID:9dbr
Status:HPUB -- hold until publication
Deposition date:2024-08-23
PDBID:9gjq
Status:HPUB -- hold until publication
Title:Crystal structure of humanised cereblon from Magnetospirillum gryphiswaldense bound by dihydrouracil-indole compound [1-(1H-indol-6-yl)dihydro-2,4(1H,3H)-pyrimidinedione].
Authors:Collie, G.W.
Deposition date:2024-08-22

225158

PDB entries from 2024-09-18

PDB statisticsPDBj update infoContact PDBjnumon