| PDBID: | 9jh9 | | Status: | AUTH -- processed, waiting for author review and approval | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9jhg | | Status: | HPUB -- hold until publication | | Title: | Cryo-em structure of beta-LG fibril | | Authors: | Xu, Y.Y., Liu, C. | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9jh4 | | Status: | HPUB -- hold until publication | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9jhh | | Status: | HPUB -- hold until publication | | Title: | Cryo-em structure of beta-LG fibril | | Authors: | Xu, Y.Y., Liu, C. | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9jhi | | Status: | HPUB -- hold until publication | | Title: | Cryo-em structure of beta-LG fibril | | Authors: | Xu, Y.Y., Liu, C. | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9jhc | | Status: | HPUB -- hold until publication | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9jhb | | Status: | HPUB -- hold until publication | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9jhd | | Status: | HPUB -- hold until publication | | Deposition date: | 2024-09-09 | | Sequence: | >Entity 1
TAIANRYEFVLLFDVENGNPNGDPDAGNMPRIDPETGHGLVTDVCLKRKIRNHVALTKEGAERFNIYIQEKAILNETHERAYTACDLKPEPKKLPKKVEDAKRVTDWMCTNFYDIRTFGAVMTTEVNCGQVRGPVQMAFARSVEPVVPQEVSITRMAVTTKAEAEKQQGDNRTMGRKHIVPYGLYVAHGFISAPLAEKTGFSDEDLTLFWDALVNMFEHDRSAARGLMSSRKLIVFKHQNRLGNAPAHKLFDLVKVSRAEGSSGPARSFADYAVTVGQAPEGVEVKEML
>Entity 2
SLDPARTDRPYLLGRLFAVLEKAQEDAVPGANATIKDRYLASASANPGQVFHMLLKNASNHTAKLRKDPERKGSAIHYEIMMQEIIDNISDFPVTMSSDEQGLFMIGYYHQRKALF
>Entity 3
UGGAUCGAAACACGACCUCGAGUCUGGUAAAGAAACCGCUGCUGCGAAAUUUGAACGCCAGCACAUGGACUCGUCUACUAGCGCAGCUUAAUUAACCUAGGCUGCUGCCACCGCUGAGCAAUAA
|
|
| PDBID: | 9dkr | | Status: | AUTH -- processed, waiting for author review and approval | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9dkn | | Status: | HPUB -- hold until publication | | Title: | Apo aplysia Slo1 R202Q | | Authors: | Gustavo, G.F., Shen, R., Latorre, R., Perozo, E. | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9dks | | Status: | HPUB -- hold until publication | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9dkp | | Status: | HPUB -- hold until publication | | Title: | The structure of human vacuolar protein sorting 34 catalytic domain bound to RD-I-53 | | Authors: | Abiodun, W.O., Tsubaki, E., Dass, R., Singleton, J.D., Samarawickrama, P., Doukov, T., Peterson, M.A., Moody, J.D. | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9dkt | | Status: | HPUB -- hold until publication | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9dkl | | Status: | HPUB -- hold until publication | | Title: | Ca2+ bound aplysia Slo1 F304A | | Authors: | Gustavo, G.F., Shen, R., Latorre, R., Perozo, E. | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9dkk | | Status: | HPUB -- hold until publication | | Title: | Designed miniproteins potently inhibit and protect against MERS-CoV. MERS-CoV S in complex with miniprotein cb3_GGGSGGGS_SB175, linker 7 (Local refinement of two RBDs and 2 miniproteins) | | Authors: | Tortorici, M.A., Veesler, D., Seattle Structural Genomics Center for Infectious Disease (SSGCID) | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9jgt | | Status: | HOLD -- hold until a certain date | | Title: | Crystal structure of HCoV 229E main protease in complex with Ibuzatrelvir | | Authors: | Jiang, H.H., Zhang, J., Li, J. | | Deposition date: | 2024-09-08 | | Release date: | 2025-09-08 |
|
| PDBID: | 9jh0 | | Status: | HPUB -- hold until publication | | Title: | Cryo-EM structure of Kcnk13 at Room Temperature. | | Authors: | Baobin, L., Ran, Z., Jin, W. | | Deposition date: | 2024-09-08 |
|
| PDBID: | 9jgp | | Status: | HOLD -- hold until a certain date | | Deposition date: | 2024-09-08 | | Release date: | 2025-09-08 |
|
| PDBID: | 9jgr | | Status: | AUTH -- processed, waiting for author review and approval | | Title: | Crystal structure of SARS-Cov-2 main protease in complex with Ibuzatrelvir | | Authors: | Zhou, X.L., Zhang, J., Li, J. | | Deposition date: | 2024-09-08 | | Release date: | 2025-09-08 |
|
| PDBID: | 9jgs | | Status: | HOLD -- hold until a certain date | | Title: | Crystal structure of SARS main protease in complex with Ibuzatrelvir | | Authors: | Jiang, H.H., Zhang, J., Li, J. | | Deposition date: | 2024-09-08 | | Release date: | 2025-09-08 |
|
| PDBID: | 9jgu | | Status: | HOLD -- hold until a certain date | | Title: | Crystal structure of HCoV-NL63 main protease with Ibuzatrelvir | | Authors: | Zhou, X.L., Zeng, X.Y., Zhang, J., Li, J. | | Deposition date: | 2024-09-08 | | Release date: | 2025-09-08 |
|
| PDBID: | 9jgv | | Status: | HOLD -- hold until a certain date | | Title: | Crystal structure of SARS-Cov-2 main protease G15S mutant in complex with Ibuzatrelvir | | Authors: | Zeng, P., Zhang, J., Li, J. | | Deposition date: | 2024-09-08 | | Release date: | 2025-09-08 |
|
| PDBID: | 9jgw | | Status: | HOLD -- hold until a certain date | | Title: | Crystal structure of SARS-Cov-2 main protease K90R mutant in complex with Ibuzatrelvir | | Authors: | Li, W.W., Zhang, J., Li, J. | | Deposition date: | 2024-09-08 | | Release date: | 2025-09-08 |
|
| PDBID: | 9jgx | | Status: | HOLD -- hold until a certain date | | Title: | Crystal structure of SARS-Cov-2 main protease E166N mutant in complex with Ibuzatrelvir | | Authors: | Zhao, Z.Y., Jiang, H.H., Zhang, J., Li, J. | | Deposition date: | 2024-09-08 | | Release date: | 2025-09-08 |
|
| PDBID: | 9jgy | | Status: | HOLD -- hold until a certain date | | Title: | Crystal structure of SARS-Cov-2 main protease E166R mutant in complex with Ibuzatrelvir | | Authors: | Zhao, Z.Y., Zhou, X.L., Li, J. | | Deposition date: | 2024-09-08 | | Release date: | 2025-09-08 |
|
