| PDBID: | 9dlc | | Status: | HPUB -- hold until publication | | Title: | Streptococcus pneumoniae GAPN with G3P | | Authors: | Eunjeong, L., Elan, Z.E. | | Deposition date: | 2024-09-10 |
|
| PDBID: | 9dlb | | Status: | HPUB -- hold until publication | | Title: | Streptococcus pneumoniae apo GAPN | | Authors: | Eunjeong, L., Elan, Z.E. | | Deposition date: | 2024-09-10 |
|
| PDBID: | 9gr2 | | Status: | HPUB -- hold until publication | | Deposition date: | 2024-09-10 |
|
| PDBID: | 9gqw | | Status: | HPUB -- hold until publication | | Title: | Ligand binding domain of the Pectobacterium atrosepticum SCRI1043 high-affinity chemoreceptor for malate | | Authors: | Gavira, J.A., Krell, T., Monteagudo-Cascales, E., Pineiro-Pineiro, J. | | Deposition date: | 2024-09-10 |
|
| PDBID: | 9jh7 | | Status: | HPUB -- hold until publication | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9jh8 | | Status: | AUTH -- processed, waiting for author review and approval | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9jhf | | Status: | HPUB -- hold until publication | | Title: | Cryo-EM structure of beta-LG fibril | | Authors: | Xu, Y.Y., Liu, C. | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9jh9 | | Status: | HPUB -- hold until publication | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9jhg | | Status: | HPUB -- hold until publication | | Title: | Cryo-em structure of beta-LG fibril | | Authors: | Xu, Y.Y., Liu, C. | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9jh4 | | Status: | HPUB -- hold until publication | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9jhh | | Status: | HPUB -- hold until publication | | Title: | Cryo-em structure of beta-LG fibril | | Authors: | Xu, Y.Y., Liu, C. | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9jhi | | Status: | HPUB -- hold until publication | | Title: | Cryo-em structure of beta-LG fibril | | Authors: | Xu, Y.Y., Liu, C. | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9jhc | | Status: | HPUB -- hold until publication | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9jhb | | Status: | HPUB -- hold until publication | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9jhd | | Status: | HPUB -- hold until publication | | Deposition date: | 2024-09-09 | | Sequence: | >Entity 1
TAIANRYEFVLLFDVENGNPNGDPDAGNMPRIDPETGHGLVTDVCLKRKIRNHVALTKEGAERFNIYIQEKAILNETHERAYTACDLKPEPKKLPKKVEDAKRVTDWMCTNFYDIRTFGAVMTTEVNCGQVRGPVQMAFARSVEPVVPQEVSITRMAVTTKAEAEKQQGDNRTMGRKHIVPYGLYVAHGFISAPLAEKTGFSDEDLTLFWDALVNMFEHDRSAARGLMSSRKLIVFKHQNRLGNAPAHKLFDLVKVSRAEGSSGPARSFADYAVTVGQAPEGVEVKEML
>Entity 2
SLDPARTDRPYLLGRLFAVLEKAQEDAVPGANATIKDRYLASASANPGQVFHMLLKNASNHTAKLRKDPERKGSAIHYEIMMQEIIDNISDFPVTMSSDEQGLFMIGYYHQRKALF
>Entity 3
UGGAUCGAAACACGACCUCGAGUCUGGUAAAGAAACCGCUGCUGCGAAAUUUGAACGCCAGCACAUGGACUCGUCUACUAGCGCAGCUUAAUUAACCUAGGCUGCUGCCACCGCUGAGCAAUAA
|
|
| PDBID: | 9dkr | | Status: | AUTH -- processed, waiting for author review and approval | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9dks | | Status: | HPUB -- hold until publication | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9dkp | | Status: | HPUB -- hold until publication | | Title: | The structure of human vacuolar protein sorting 34 catalytic domain bound to RD-I-53 | | Authors: | Abiodun, W.O., Tsubaki, E., Dass, R., Singleton, J.D., Samarawickrama, P., Doukov, T., Peterson, M.A., Moody, J.D. | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9dkt | | Status: | HPUB -- hold until publication | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9dkk | | Status: | HPUB -- hold until publication | | Title: | Designed miniproteins potently inhibit and protect against MERS-CoV. MERS-CoV S in complex with miniprotein cb3_GGGSGGGS_SB175, linker 7 (Local refinement of two RBDs and 2 miniproteins) | | Authors: | Tortorici, M.A., Veesler, D., Seattle Structural Genomics Center for Infectious Disease (SSGCID) | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9gq1 | | Status: | HPUB -- hold until publication | | Title: | CSP1 H36A | | Authors: | Basle, A., David, S., Dennison, C. | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9gq0 | | Status: | HPUB -- hold until publication | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9gqm | | Status: | AUTH -- processed, waiting for author review and approval | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9gqp | | Status: | AUTH -- processed, waiting for author review and approval | | Deposition date: | 2024-09-09 |
|
| PDBID: | 9gqs | | Status: | HPUB -- hold until publication | | Title: | Teth514_1788 1,2-beta-oligomannan phosphorylase in complex with mannose (+1) and phosphate | | Authors: | Cioci, G., Durand, J., Veronese-Potocki, G., Ladeveze, S. | | Deposition date: | 2024-09-09 |
|
