4P0P
 
 | | Crystal structure of Human Mus81-Eme1 in complex with 5'-flap DNA, and Mg2+ | | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCTCAATC, ... | | Authors: | Gwon, G.H, Baek, K, Cho, Y. | | Deposit date: | 2014-02-22 | | Release date: | 2014-05-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates.
Embo J., 33, 2014
|
|
4P0R
 | | human Mus81-Eme1-3'flap DNA complex | | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA ACGTGCTTACACACAGAGGTTAGGGTGAACTT, ... | | Authors: | Gwon, G.H, Baek, K, Cho, Y. | | Deposit date: | 2014-02-22 | | Release date: | 2014-05-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (6.501 Å) | | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates.
Embo J., 33, 2014
|
|
4P0Q
 | | Crystal structure of Human Mus81-Eme1 in complex with 5'-flap DNA | | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCTCAATC, ... | | Authors: | Gwon, G.H, Baek, K, Cho, Y. | | Deposit date: | 2014-02-22 | | Release date: | 2014-05-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.851 Å) | | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates.
Embo J., 33, 2014
|
|
4P0S
 | | human Mus81-Eme1-3'flap DNA complex | | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCT, ... | | Authors: | Gwon, G.H, Baek, K, Cho, Y. | | Deposit date: | 2014-02-22 | | Release date: | 2014-05-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (6 Å) | | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates.
Embo J., 33, 2014
|
|
