1R1B
| EPRS SECOND REPEATED ELEMENT, NMR, MINIMIZED AVERAGE STRUCTURE | Descriptor: | TRNA SYNTHETASE | Authors: | Cahuzac, B, Berthonneau, E, Birlirakis, N, Mirande, M, Guittet, E. | Deposit date: | 1998-12-15 | Release date: | 1999-12-15 | Last modified: | 2023-12-27 | Method: | SOLUTION NMR | Cite: | A recurrent RNA-binding domain is appended to eukaryotic aminoacyl-tRNA synthetases. EMBO J., 19, 2000
|
|
1TYO
| Isocitrate Dehydrogenase from the hyperthermophile Aeropyrum pernix in complex with etheno-NADP | Descriptor: | ETHENO-NADP, isocitrate dehydrogenase | Authors: | Karlstrom, M, Stokke, R, Steen, I.H, Birkeland, N, Ladenstein, R. | Deposit date: | 2004-07-08 | Release date: | 2005-07-08 | Last modified: | 2023-10-25 | Method: | X-RAY DIFFRACTION (2.15 Å) | Cite: | Isocitrate dehydrogenase from the hyperthermophile Aeropyrum pernix: X-ray structure analysis of a ternary enzyme-substrate complex and thermal stability J.Mol.Biol., 345, 2005
|
|
4HLX
| |
2HZ7
| Crystal structure of the Glutaminyl-tRNA synthetase from Deinococcus radiodurans | Descriptor: | Glutaminyl-tRNA synthetase | Authors: | Deniziak, M, Sauter, C, Becker, H.D, Paulus, C, Giege, R, Kern, D. | Deposit date: | 2006-08-08 | Release date: | 2007-04-24 | Last modified: | 2023-08-30 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | Deinococcus glutaminyl-tRNA synthetase is a chimer between proteins from an ancient and the modern pathways of aminoacyl-tRNA formation Nucleic Acids Res., 35, 2007
|
|
1R5T
| The Crystal Structure of Cytidine Deaminase CDD1, an Orphan C to U editase from Yeast | Descriptor: | Cytidine deaminase, ZINC ION | Authors: | Xie, K, Sowden, M.P, Dance, G.S.C, Torelli, A.T, Smith, H.C, Wedekind, J.E. | Deposit date: | 2003-10-13 | Release date: | 2004-05-25 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | The structure of a yeast RNA-editing deaminase provides insight into the fold and function of activation-induced deaminase and APOBEC-1. Proc.Natl.Acad.Sci.Usa, 101, 2004
|
|
1RGW
| Solution Structure of ZASP's PDZ domain | Descriptor: | ZASP protein | Authors: | Au, Y, Atkinson, R.A, Pallavicini, A, Joseph, C, Martin, S.R, Muskett, F.W, Guerrini, R, Faulkner, G, Pastore, A. | Deposit date: | 2003-11-13 | Release date: | 2004-04-13 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | Solution Structure of ZASP PDZ Domain; Implications for Sarcomere Ultrastructure and Enigma Family Redundancy. Structure, 12, 2004
|
|
7SQK
| Cryo-EM structure of the human augmin complex | Descriptor: | HAUS augmin-like complex subunit 1, HAUS augmin-like complex subunit 2, HAUS augmin-like complex subunit 3, ... | Authors: | Gabel, C.A, Chang, L. | Deposit date: | 2021-11-05 | Release date: | 2022-09-21 | Last modified: | 2024-06-05 | Method: | ELECTRON MICROSCOPY (8 Å) | Cite: | Molecular architecture of the augmin complex. Nat Commun, 13, 2022
|
|
8IMZ
| Cryo-EM structure of mouse Piezo1-MDFIC complex (composite map) | Descriptor: | MyoD family inhibitor domain-containing protein, Piezo-type mechanosensitive ion channel component 1 | Authors: | Zhou, Z, Ma, X, Lin, Y, Cheng, D, Bavi, N, Li, J.V, Sutton, D, Yao, M, Harvey, N, Corry, B, Zhang, Y, Cox, C.D. | Deposit date: | 2023-03-07 | Release date: | 2023-08-09 | Last modified: | 2023-08-30 | Method: | ELECTRON MICROSCOPY (3.66 Å) | Cite: | MyoD-family inhibitor proteins act as auxiliary subunits of Piezo channels. Science, 381, 2023
|
|
2J4F
| Torpedo acetylcholinesterase - Hg heavy-atom derivative | Descriptor: | ACETYLCHOLINESTERASE, MERCURY (II) ION | Authors: | Kreimer, D.I, Dolginova, E.A, Raves, M, Sussman, J.L, Silman, I, Weiner, L. | Deposit date: | 2006-08-30 | Release date: | 2006-09-05 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | A Metastable State of Torpedo Californica Acetylcholinesterase Generated by Modification with Organomercurials Biochemistry, 33, 1994
|
|
7KUF
| Transcription activation subcomplex with WhiB7 bound to SigmaAr4-RNAP Beta flap tip chimera and DNA | Descriptor: | DNA (5'-D(*CP*AP*GP*AP*AP*AP*AP*TP*CP*GP*GP*TP*TP*GP*TP*GP*GP*T)-3'), DNA (5'-D(*GP*AP*CP*CP*AP*CP*AP*AP*CP*CP*GP*AP*TP*TP*TP*TP*CP*T)-3'), IRON/SULFUR CLUSTER, ... | Authors: | Wan, T, Horova, M, Beltran, D.G, Li, S.R, Zhang, L.M. | Deposit date: | 2020-11-24 | Release date: | 2021-06-30 | Last modified: | 2023-10-18 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Structural insights into the functional divergence of WhiB-like proteins in Mycobacterium tuberculosis. Mol.Cell, 81, 2021
|
|
7KUG
| Fe-S cluster-bound transcription activator WhiB7 in complex with the SigmaAr4-RNAP Beta flap tip chimera | Descriptor: | IRON/SULFUR CLUSTER, Probable transcriptional regulator WhiB7, RNA polymerase sigma factor, ... | Authors: | Wan, T, Horova, M, Beltran, D.G, Li, S.R, Zhang, L.M. | Deposit date: | 2020-11-24 | Release date: | 2021-06-30 | Last modified: | 2021-10-06 | Method: | X-RAY DIFFRACTION (1.55 Å) | Cite: | Structural insights into the functional divergence of WhiB-like proteins in Mycobacterium tuberculosis. Mol.Cell, 81, 2021
|
|
1ODC
| STRUCTURE OF ACETYLCHOLINESTERASE (E.C. 3.1.1.7) COMPLEXED WITH N-4'-QUINOLYL-N'-9"-(1",2",3",4"-TETRAHYDROACRIDINYL)-1,8- DIAMINOOCTANE AT 2.2A RESOLUTION | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, ACETYLCHOLINESTERASE, N-QUINOLIN-4-YL-N'-(1,2,3,4-TETRAHYDROACRIDIN-9-YL)OCTANE-1,8-DIAMINE | Authors: | Wong, D.M, Greenblatt, H.M, Carlier, P.R, Han, Y.-F, Pang, Y.-P, Silman, I, Sussman, J.L. | Deposit date: | 2003-02-15 | Release date: | 2005-03-23 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | Complexes of Alkylene-Linked Tacrine Dimers with Torpedo Californica Acetylcholinesterase: Binding of Bis(5)-Tacrine Produces a Dramatic Rearrangement in the Active-Site Gorge. J.Med.Chem., 49, 2006
|
|
1R7Z
| NMR STRUCTURE OF THE R(GGAGGACAUUCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUUCCU BULGE | Descriptor: | 34-MER | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | Deposit date: | 2003-10-22 | Release date: | 2004-05-25 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,). Biochemistry, 43, 2004
|
|
7KIF
| Mycobacterium tuberculosis WT RNAP transcription open promoter complex with WhiB7 transcription factor | Descriptor: | DNA (55-MER), DNA (63-MER), DNA-directed RNA polymerase subunit alpha, ... | Authors: | Lilic, M, Darst, S.A, Campbell, E.A. | Deposit date: | 2020-10-23 | Release date: | 2021-04-21 | Last modified: | 2024-05-29 | Method: | ELECTRON MICROSCOPY (2.94 Å) | Cite: | Structural basis of transcriptional activation by the Mycobacterium tuberculosis intrinsic antibiotic-resistance transcription factor WhiB7. Mol.Cell, 81, 2021
|
|
7KIM
| Mycobacterium tuberculosis WT RNAP transcription closed promoter complex with WhiB7 transcription factor | Descriptor: | DNA (45-MER), DNA-directed RNA polymerase subunit alpha, DNA-directed RNA polymerase subunit beta, ... | Authors: | Lilic, M, Darst, S.A, Campbell, E.A. | Deposit date: | 2020-10-23 | Release date: | 2021-04-21 | Last modified: | 2024-05-29 | Method: | ELECTRON MICROSCOPY (3.38 Å) | Cite: | Structural basis of transcriptional activation by the Mycobacterium tuberculosis intrinsic antibiotic-resistance transcription factor WhiB7. Mol.Cell, 81, 2021
|
|
7KIN
| Mycobacterium tuberculosis WT RNAP transcription open promoter complex with WhiB7 promoter | Descriptor: | DNA (49-MER), DNA (54-MER), DNA-directed RNA polymerase subunit alpha, ... | Authors: | Lilic, M, Darst, S.A, Campbell, E.A. | Deposit date: | 2020-10-23 | Release date: | 2021-04-21 | Last modified: | 2024-05-29 | Method: | ELECTRON MICROSCOPY (2.74 Å) | Cite: | Structural basis of transcriptional activation by the Mycobacterium tuberculosis intrinsic antibiotic-resistance transcription factor WhiB7. Mol.Cell, 81, 2021
|
|
2J3D
| |
4H4L
| Crystal Structure of ternary complex of HutP(HutP-L-His-Zn) | Descriptor: | HISTIDINE, Hut operon positive regulatory protein, ZINC ION | Authors: | Dhakshnamoorthy, B, Misono, T.S, Mizuno, H, Kumar, P.K.R. | Deposit date: | 2012-09-17 | Release date: | 2013-09-04 | Last modified: | 2023-11-08 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | Alternative binding modes of l-histidine guided by metal ions for the activation of the antiterminator protein HutP of Bacillus subtilis. J.Struct.Biol., 183, 2013
|
|
1R7W
| NMR STRUCTURE OF THE R(GGAGGACAUCCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUCCCU BULGE | Descriptor: | 34-MER | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | Deposit date: | 2003-10-22 | Release date: | 2004-05-25 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,). Biochemistry, 43, 2004
|
|
1UTD
| The structure of the trp RNA-binding attenuation protein (TRAP) bound to a 63-nucleotide RNA molecule containing GAGUUU repeats | Descriptor: | 5'-R(*GP*UP*UP*UP*GP*AP)-3', TRANSCRIPTION ATTENUATION PROTEIN MTRB, TRYPTOPHAN | Authors: | Hopcroft, N.H, Manfredo, A, Wendt, A.L, Brzozowski, A.M, Gollnick, P, Antson, A.A. | Deposit date: | 2003-12-08 | Release date: | 2004-01-15 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (2.1 Å) | Cite: | The Interaction of RNA with Trap: The Role of Triplet Repeats and Separating Spacer Nucleotides J.Mol.Biol., 338, 2004
|
|
1V7F
| Solution structure of phrixotoxin 1 | Descriptor: | Phrixotoxin 1 | Authors: | Chagot, B, Escoubas, P, Villegas, E, Bernard, C, Ferrat, G, Corzo, G, Lazdunski, M, Darbon, H. | Deposit date: | 2003-12-16 | Release date: | 2004-11-23 | Last modified: | 2023-12-27 | Method: | SOLUTION NMR | Cite: | Solution structure of Phrixotoxin 1, a specific peptide inhibitor of Kv4 potassium channels from the venom of the theraphosid spider Phrixotrichus auratus Protein Sci., 13, 2004
|
|
1V5B
| The Structure Of The Mutant, S225A and E251L, Of 3-Isopropylmalate Dehydrogenase From Bacillus Coagulans | Descriptor: | 3-isopropylmalate dehydrogenase, SULFATE ION | Authors: | Fujita, K, Minami, H, Suzuki, K, Tsunoda, M, Sekiguchi, T, Mizui, R, Tsuzaki, S, Nakamura, S, Takenaka, A. | Deposit date: | 2003-11-22 | Release date: | 2005-02-15 | Last modified: | 2023-10-25 | Method: | X-RAY DIFFRACTION (2.95 Å) | Cite: | Crystal structure of a highly thermo-stabilized mutant of 3-isopropylmalate dehydrogenase from Bacillus coagulans: An evaluation of local packing density in the hydrophobic core To be Published
|
|
4J2G
| Atg13 HORMA domain | Descriptor: | KLTH0A00704p, SULFATE ION | Authors: | Jao, C, Stanley, R.E, Ragusa, M.J, Hurley, J.H. | Deposit date: | 2013-02-04 | Release date: | 2013-03-20 | Last modified: | 2013-04-17 | Method: | X-RAY DIFFRACTION (2.29 Å) | Cite: | A HORMA domain in Atg13 mediates PI 3-kinase recruitment in autophagy. Proc.Natl.Acad.Sci.USA, 110, 2013
|
|
4ICD
| REGULATION OF ISOCITRATE DEHYDROGENASE BY PHOSPHORYLATION INVOLVES NO LONG-RANGE CONFORMATIONAL CHANGE IN THE FREE ENZYME | Descriptor: | PHOSPHORYLATED ISOCITRATE DEHYDROGENASE | Authors: | Hurley, J.H, Dean, A.M, Thorsness, P.E, Koshlandjunior, D.E, Stroud, R.M. | Deposit date: | 1989-12-28 | Release date: | 1991-01-15 | Last modified: | 2017-11-29 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | Regulation of isocitrate dehydrogenase by phosphorylation involves no long-range conformational change in the free enzyme. J.Biol.Chem., 265, 1990
|
|
1V53
| The crystal structure of 3-isopropylmalate dehydrogenase from Bacillus coagulans | Descriptor: | 3-isopropylmalate dehydrogenase | Authors: | Fujita, K, Minami, H, Suzuki, K, Tsunoda, M, Sekiguchi, T, Mizui, R, Tsuzaki, S, Nakamura, S, Takenaka, A. | Deposit date: | 2003-11-20 | Release date: | 2005-02-15 | Last modified: | 2023-10-25 | Method: | X-RAY DIFFRACTION (2.85 Å) | Cite: | The crystal structure of 3-isopropylmalate dehydrogenase from Bacillus coagulans To be Published
|
|