1KX4
| X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution | Descriptor: | CHLORIDE ION, DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3'), MANGANESE (II) ION, ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
1CNS
| |
4AKT
| PatG macrocyclase in complex with peptide | Descriptor: | SUBSTRATE ANALOGUE, THIAZOLINE OXIDASE/SUBTILISIN-LIKE PROTEASE | Authors: | Koehnke, J, Bent, A, Houssen, W.E, Zollman, D, Morawitz, F, Shirran, S, Vendome, J, Nneoyiegbe, A.F, Trembleau, L, Botting, C.H, Smith, M.C.M, Jaspars, M, Naismith, J.H. | Deposit date: | 2012-02-28 | Release date: | 2012-07-18 | Last modified: | 2013-11-06 | Method: | X-RAY DIFFRACTION (2.63 Å) | Cite: | The Mechanism of Patellamide Macrocyclization Revealed by the Characterization of the Patg Macrocyclase Domain. Nat.Struct.Mol.Biol., 19, 2012
|
|
3FQQ
| Crystal structure of a novel dimeric form of HCV NS5A domain I protein | Descriptor: | 3-methyl-1-(2-methylpropyl)butyl 4-O-beta-L-gulopyranosyl-beta-D-glucopyranoside, GLYCEROL, Non-structural protein 5A, ... | Authors: | Love, R.A. | Deposit date: | 2009-01-07 | Release date: | 2009-03-24 | Last modified: | 2023-09-06 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | Crystal structure of a novel dimeric form of NS5A domain I protein from hepatitis C virus J.Virol., 83, 2009
|
|
4MAH
| Structure of Aspergillus oryzae AA11 Lytic Polysaccharide Monooxygenase with Zn | Descriptor: | 1,2-ETHANEDIOL, AA11 Lytic Polysaccharide Monooxygenase, CHLORIDE ION, ... | Authors: | Hemsworth, G.R, Henrissat, B, Walton, P.H, Davies, G.J. | Deposit date: | 2013-08-16 | Release date: | 2013-12-18 | Last modified: | 2017-11-15 | Method: | X-RAY DIFFRACTION (1.55 Å) | Cite: | Discovery and characterization of a new family of lytic polysaccharide monooxygenases. Nat.Chem.Biol., 10, 2014
|
|
6CVX
| Crystal structure of HCV NS3/4A WT protease in complex with AJ-50 (MK-5172 linear analogue) | Descriptor: | GLYCEROL, N-[(cyclopentyloxy)carbonyl]-3-methyl-L-valyl-(4R)-N-[(1R,2S)-2-ethenyl-1-{[(1-methylcyclopropyl)sulfonyl]carbamoyl}cyclopropyl]-4-{[7-methoxy-3-(propan-2-yl)quinoxalin-2-yl]oxy}-L-prolinamide, NS3 protease, ... | Authors: | Matthew, A.N, Schiffer, C.A. | Deposit date: | 2018-03-29 | Release date: | 2018-08-08 | Last modified: | 2023-10-04 | Method: | X-RAY DIFFRACTION (1.779 Å) | Cite: | Quinoxaline-Based Linear HCV NS3/4A Protease Inhibitors Exhibit Potent Activity against Drug Resistant Variants. ACS Med Chem Lett, 9, 2018
|
|
1KWG
| Crystal structure of Thermus thermophilus A4 beta-galactosidase | Descriptor: | (4S)-2-METHYL-2,4-PENTANEDIOL, ACETATE ION, BETA-GALACTOSIDASE, ... | Authors: | Hidaka, M, Fushinobu, S, Ohtsu, N, Motoshima, H, Matsuzawa, H, Shoun, H, Wakagi, T. | Deposit date: | 2002-01-29 | Release date: | 2002-09-18 | Last modified: | 2024-03-13 | Method: | X-RAY DIFFRACTION (1.6 Å) | Cite: | Trimeric Crystal Structure of the Glycoside Hydrolase Family 42 beta-Galactosidase from Thermus thermophilus A4 and the Structure of its Complex with Galactose J.MOL.BIOL., 322, 2002
|
|
1Y5V
| tRNA-Guanine Transglycosylase (TGT) in complex with 6-Amino-4-(2-phenylethyl)-1,7-dihydro-8H-imidazo[4,5-g]quinazolin-8-one | Descriptor: | 6-AMINO-4-(2-PHENYLETHYL)-1,7-DIHYDRO-8H-IMIDAZO[4,5-G]QUINAZOLIN-8-ONE, GLYCEROL, Queuine tRNA-ribosyltransferase, ... | Authors: | Stengl, B, Meyer, E.A, Heine, A, Brenk, R, Diederich, F, Klebe, G. | Deposit date: | 2004-12-03 | Release date: | 2005-12-13 | Last modified: | 2023-10-25 | Method: | X-RAY DIFFRACTION (1.58 Å) | Cite: | Crystal structures of tRNA-guanine transglycosylase (TGT) in complex with novel and potent inhibitors unravel pronounced induced-fit adaptations and suggest dimer formation upon substrate binding J.Mol.Biol., 370, 2007
|
|
4HXL
| Brd4 Bromodomain 1 complex with 3-CYCLOHEXYL-N-{3-(2-OXO-2,3-DIHYDRO-1,3-THIAZOL-4-YL)-5-[(THIOPHEN-2-YLSULFONYL)AMINO]PHENYL}PROPANAMIDE inhibitor | Descriptor: | 3-cyclohexyl-N-{3-(2-oxo-2,3-dihydro-1,3-thiazol-4-yl)-5-[(thiophen-2-ylsulfonyl)amino]phenyl}propanamide, Bromodomain-containing protein 4 | Authors: | Chen, T.T, Cao, D.Y, Chen, W.Y, Xiong, B, Shen, J.K, Xu, Y.C. | Deposit date: | 2012-11-12 | Release date: | 2013-04-03 | Last modified: | 2024-02-28 | Method: | X-RAY DIFFRACTION (1.52 Å) | Cite: | Fragment-Based Drug Discovery of 2-Thiazolidinones as Inhibitors of the Histone Reader BRD4 Bromodomain. J.Med.Chem., 56, 2013
|
|
4TQP
| Human transthyretin (TTR) complexed with (R)-3-(9H-fluoren-9-ylideneaminooxy)-2-methyl-N-(methylsulfonyl) propionamide in a dual binding mode | Descriptor: | (2R)-3-[(9H-fluoren-9-ylideneamino)oxy]-2-methyl-N-(methylsulfonyl)propanamide, GLYCEROL, Transthyretin | Authors: | Ciccone, L, Nencetti, S, Rossello, A, Orlandini, E, Stura, E.A. | Deposit date: | 2014-06-11 | Release date: | 2015-06-24 | Last modified: | 2023-09-27 | Method: | X-RAY DIFFRACTION (1.58 Å) | Cite: | X-ray crystal structure and activity of fluorenyl-based compounds as transthyretin fibrillogenesis inhibitors. J Enzyme Inhib Med Chem, 2015
|
|
4MBE
| Sac3:Sus1:Cdc31:Nup1 complex | Descriptor: | CALCIUM ION, Cell division control protein 31, Nuclear mRNA export protein SAC3, ... | Authors: | Jani, D, Meineke, B, Stewart, M. | Deposit date: | 2013-08-19 | Release date: | 2014-07-02 | Last modified: | 2023-09-20 | Method: | X-RAY DIFFRACTION (2.612 Å) | Cite: | Structural basis for binding the TREX2 complex to nuclear pores, GAL1 localisation and mRNA export. Nucleic Acids Res., 42, 2014
|
|
5C1I
| m1A58 tRNA methyltransferase mutant - D170A | Descriptor: | SULFATE ION, tRNA (adenine(58)-N(1))-methyltransferase TrmI | Authors: | Ponchon, L, Degut, C, Folly-Klan, M, Barraud, P, Tisne, C. | Deposit date: | 2015-06-14 | Release date: | 2015-06-24 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (3.1 Å) | Cite: | The m1A58 modification in eubacterial tRNA: An overview of tRNA recognition and mechanism of catalysis by TrmI. Biophys.Chem., 210, 2016
|
|
2B8R
| Structure oF HIV-1(LAI) genomic RNA DIS | Descriptor: | 5'-R(*CP*UP*UP*GP*CP*UP*GP*AP*AP*GP*CP*GP*CP*GP*CP*AP*CP*GP*GP*CP*AP*AP*G)-3', MAGNESIUM ION, SODIUM ION, ... | Authors: | Ennifar, E, Walter, P, Ehresmann, B, Ehresmann, C, Dumas, P. | Deposit date: | 2005-10-10 | Release date: | 2005-10-25 | Last modified: | 2023-08-23 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Crystal structures of coaxially stacked kissing complexes of the HIV-1 RNA dimerization initiation site Nat.Struct.Biol., 8, 2001
|
|
1YZ5
| |
4HVJ
| |
1KX3
| X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution | Descriptor: | DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3'), MANGANESE (II) ION, histone H2A.1, ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
1DGB
| HUMAN ERYTHROCYTE CATALASE | Descriptor: | CATALASE, NADPH DIHYDRO-NICOTINAMIDE-ADENINE-DINUCLEOTIDE PHOSPHATE, PROTOPORPHYRIN IX CONTAINING FE | Authors: | Putnam, C.D, Arvai, A.S, Bourne, Y, Tainer, J.A. | Deposit date: | 1999-11-23 | Release date: | 2000-02-11 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | Active and inhibited human catalase structures: ligand and NADPH binding and catalytic mechanism. J.Mol.Biol., 296, 2000
|
|
4HXM
| Brd4 Bromodomain 1 complex with N-{3-(2-OXO-2,3-DIHYDRO-1,3-THIAZOL-4-YL)-5-[(THIOPHEN-2-YLSULFONYL)AMINO]PHENYL}BUTANAMIDE inhibitor | Descriptor: | Bromodomain-containing protein 4, N-{3-(2-oxo-2,3-dihydro-1,3-thiazol-4-yl)-5-[(thiophen-2-ylsulfonyl)amino]phenyl}butanamide | Authors: | Chen, T.T, Cao, D.Y, Chen, W.Y, Xiong, B, Shen, J.K, Xu, Y.C. | Deposit date: | 2012-11-12 | Release date: | 2013-04-03 | Last modified: | 2024-02-28 | Method: | X-RAY DIFFRACTION (1.5 Å) | Cite: | Fragment-Based Drug Discovery of 2-Thiazolidinones as Inhibitors of the Histone Reader BRD4 Bromodomain. J.Med.Chem., 56, 2013
|
|
4RPX
| |
1DMH
| STRUCTURE OF CATECHOL 1,2-DIOXYGENASE FROM ACINETOBACTER SP. ADP1 WITH BOUND 4-METHYLCATECHOL | Descriptor: | 4-METHYLCATECHOL, CATECHOL 1,2-DIOXYGENASE, FE (III) ION, ... | Authors: | Vetting, M.W, Ohlendorf, D.H. | Deposit date: | 1999-12-14 | Release date: | 2000-05-23 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (1.7 Å) | Cite: | The 1.8 A crystal structure of catechol 1,2-dioxygenase reveals a novel hydrophobic helical zipper as a subunit linker. Structure Fold.Des., 8, 2000
|
|
1DMW
| CRYSTAL STRUCTURE OF DOUBLE TRUNCATED HUMAN PHENYLALANINE HYDROXYLASE WITH BOUND 7,8-DIHYDRO-L-BIOPTERIN | Descriptor: | 7,8-DIHYDROBIOPTERIN, FE (III) ION, PHENYLALANINE HYDROXYLASE | Authors: | Erlandsen, H, Stevens, R.C, Flatmark, T. | Deposit date: | 1999-12-15 | Release date: | 2000-03-24 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Crystal structure and site-specific mutagenesis of pterin-bound human phenylalanine hydroxylase. Biochemistry, 39, 2000
|
|
4NEF
| X-ray structure of human Aquaporin 2 | Descriptor: | Aquaporin-2, CADMIUM ION, ZINC ION | Authors: | Frick, A, Eriksson, U, Mattia, F.D, Oberg, F, Hedfalk, K, Neutze, R, Grip, W.D, Deen, P.M.T, Tornroth-horsefield, S. | Deposit date: | 2013-10-29 | Release date: | 2014-04-16 | Last modified: | 2014-12-10 | Method: | X-RAY DIFFRACTION (2.75 Å) | Cite: | X-ray structure of human aquaporin 2 and its implications for nephrogenic diabetes insipidus and trafficking Proc.Natl.Acad.Sci.USA, 111, 2014
|
|
6IL7
| Structure of Enterococcus faecalis (V583) alkylhydroperoxide reductase subunit F (AhpF) C503A mutant | Descriptor: | SULFATE ION, Thioredoxin reductase/glutathione-related protein | Authors: | Toh, Y.K, Shin, J, Balakrishna, A.M, Eisenhaber, F, Eisenhaber, B, Gruber, G. | Deposit date: | 2018-10-17 | Release date: | 2019-05-22 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | Effect of the additional cysteine 503 of vancomycin-resistant Enterococcus faecalis (V583) alkylhydroperoxide reductase subunit F (AhpF) and the mechanism of AhpF and subunit C assembling. Free Radic. Biol. Med., 138, 2019
|
|
6EHK
| The crystal structure of CK2alpha in complex with CAM4712 and compound 37 | Descriptor: | 2-(1~{H}-benzimidazol-2-yl)-~{N}-[[3,5-bis(chloranyl)-4-(2-ethylphenyl)phenyl]methyl]ethanamine, 2-hydroxy-5-methylbenzoic acid, ACETATE ION, ... | Authors: | Brear, P, De Fusco, C, Iegre, J, Yoshida, M, Mitchell, S, Rossmann, M, Carro, L, Sore, H, Hyvonen, M, Spring, D. | Deposit date: | 2017-09-13 | Release date: | 2018-02-28 | Last modified: | 2024-01-17 | Method: | X-RAY DIFFRACTION (1.4 Å) | Cite: | Second-generation CK2 alpha inhibitors targeting the alpha D pocket. Chem Sci, 9, 2018
|
|
6EHU
| The crystal structure of CK2alpha in complex with compound 32 | Descriptor: | 2-(1~{H}-benzimidazol-2-yl)-~{N}-[[4-(2-ethylphenyl)-3-(trifluoromethyl)phenyl]methyl]ethanamine, ACETATE ION, Casein kinase II subunit alpha | Authors: | Brear, P, De Fusco, C, Iegre, J, Yoshida, M, Mitchell, S, Rossmann, M, Carro, L, Sore, H, Hyvonen, M, Spring, D. | Deposit date: | 2017-09-15 | Release date: | 2018-02-28 | Last modified: | 2024-01-17 | Method: | X-RAY DIFFRACTION (1.95 Å) | Cite: | Second-generation CK2 alpha inhibitors targeting the alpha D pocket. Chem Sci, 9, 2018
|
|