1G60
![Download](https://newweb-cs.pages.dev/newweb/media/icons/dl.png) ![Visualize](https://newweb-cs.pages.dev/newweb/media/icons/hoh_3d.png)
![BU of 1g60 by Molmil](/molmil-images/mine/1g60) | Crystal Structure of Methyltransferase MboIIa (Moraxella bovis) | Descriptor: | Adenine-specific Methyltransferase MboIIA, S-ADENOSYLMETHIONINE, SODIUM ION | Authors: | Osipiuk, J, Walsh, M.A, Joachimiak, A, Midwest Center for Structural Genomics (MCSG) | Deposit date: | 2000-11-02 | Release date: | 2002-05-01 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (1.74 Å) | Cite: | Crystal structure of MboIIA methyltransferase. Nucleic Acids Res., 31, 2003
|
|
7DSU
![Download](https://newweb-cs.pages.dev/newweb/media/icons/dl.png) ![Visualize](https://newweb-cs.pages.dev/newweb/media/icons/hoh_3d.png)
![BU of 7dsu by Molmil](/molmil-images/mine/7dsu) | Structure of Mod subunit of the Type III restriction-modification enzyme Mbo45V | Descriptor: | 1,2-ETHANEDIOL, Mbo45V, SINEFUNGIN | Authors: | Ahmed, I, Chouhan, O.P, Gopinath, A, Morgan, R.D, Bhagat, K, Singh, A, Saikrishnan, K. | Deposit date: | 2021-01-02 | Release date: | 2022-01-05 | Last modified: | 2023-04-05 | Method: | X-RAY DIFFRACTION (3.2 Å) | Cite: | Structure of Mod subunit of the Type III restriction-modification enzyme Mbo45V To Be Published
|
|
6K0W
![Download](https://newweb-cs.pages.dev/newweb/media/icons/dl.png) ![Visualize](https://newweb-cs.pages.dev/newweb/media/icons/hoh_3d.png)
![BU of 6k0w by Molmil](/molmil-images/mine/6k0w) | DNA methyltransferase in complex with sinefungin | Descriptor: | Adenine specific DNA methyltransferase (Mod), SINEFUNGIN | Authors: | Narayanan, N, Nair, D.T. | Deposit date: | 2019-05-07 | Release date: | 2019-12-11 | Last modified: | 2024-03-27 | Method: | X-RAY DIFFRACTION (2.65 Å) | Cite: | Tetramerization at Low pH Licenses DNA Methylation Activity of M.HpyAXI in the Presence of Acid Stress. J.Mol.Biol., 432, 2020
|
|
5HFJ
![Download](https://newweb-cs.pages.dev/newweb/media/icons/dl.png) ![Visualize](https://newweb-cs.pages.dev/newweb/media/icons/hoh_3d.png)
![BU of 5hfj by Molmil](/molmil-images/mine/5hfj) | crystal structure of M1.HpyAVI-SAM complex | Descriptor: | Adenine specific DNA methyltransferase (DpnA), S-ADENOSYLMETHIONINE | Authors: | Ma, B, Liu, W, Zhang, H. | Deposit date: | 2016-01-07 | Release date: | 2016-11-16 | Last modified: | 2023-11-08 | Method: | X-RAY DIFFRACTION (3.1 Å) | Cite: | Biochemical and structural characterization of a DNA N6-adenine methyltransferase from Helicobacter pylori Oncotarget, 7, 2016
|
|
5HEK
![Download](https://newweb-cs.pages.dev/newweb/media/icons/dl.png) ![Visualize](https://newweb-cs.pages.dev/newweb/media/icons/hoh_3d.png)
![BU of 5hek by Molmil](/molmil-images/mine/5hek) | crystal structure of M1.HpyAVI | Descriptor: | Adenine specific DNA methyltransferase (DpnA) | Authors: | Ma, B, Zhang, H, Liu, W. | Deposit date: | 2016-01-06 | Release date: | 2016-11-16 | Last modified: | 2023-11-08 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | Biochemical and structural characterization of a DNA N6-adenine methyltransferase from Helicobacter pylori Oncotarget, 7, 2016
|
|
1BOO
![Download](https://newweb-cs.pages.dev/newweb/media/icons/dl.png) ![Visualize](https://newweb-cs.pages.dev/newweb/media/icons/hoh_3d.png)
![BU of 1boo by Molmil](/molmil-images/mine/1boo) | PVUII DNA METHYLTRANSFERASE (CYTOSINE-N4-SPECIFIC) | Descriptor: | PROTEIN (N-4 CYTOSINE-SPECIFIC METHYLTRANSFERASE PVU II), S-ADENOSYL-L-HOMOCYSTEINE | Authors: | Gong, W, O'Gara, M, Blumenthal, R.M, Cheng, X. | Deposit date: | 1998-07-31 | Release date: | 1998-08-12 | Last modified: | 2024-05-22 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | Structure of pvu II DNA-(cytosine N4) methyltransferase, an example of domain permutation and protein fold assignment. Nucleic Acids Res., 25, 1997
|
|
1EG2
![Download](https://newweb-cs.pages.dev/newweb/media/icons/dl.png) ![Visualize](https://newweb-cs.pages.dev/newweb/media/icons/hoh_3d.png)
![BU of 1eg2 by Molmil](/molmil-images/mine/1eg2) | CRYSTAL STRUCTURE OF RHODOBACTER SPHEROIDES (N6 ADENOSINE) METHYLTRANSFERASE (M.RSRI) | Descriptor: | 5'-DEOXY-5'-METHYLTHIOADENOSINE, MODIFICATION METHYLASE RSRI | Authors: | Scavetta, R.D, Thomas, C.B, Walsh, M.A, Szegedi, S, Joachimiak, A, Gumport, R.I, Churchill, M.E.A, Midwest Center for Structural Genomics (MCSG) | Deposit date: | 2000-02-11 | Release date: | 2000-10-18 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (1.75 Å) | Cite: | Structure of RsrI methyltransferase, a member of the N6-adenine beta class of DNA methyltransferases. Nucleic Acids Res., 28, 2000
|
|
2ZIE
![Download](https://newweb-cs.pages.dev/newweb/media/icons/dl.png) ![Visualize](https://newweb-cs.pages.dev/newweb/media/icons/hoh_3d.png)
![BU of 2zie by Molmil](/molmil-images/mine/2zie) | Crystal Structure of TTHA0409, Putatative DNA Modification Methylase from Thermus thermophilus HB8- Selenomethionine derivative | Descriptor: | Putative modification methylase | Authors: | Morita, R, Ishikawa, H, Nakagawa, N, Masui, R, Yokoyama, S, Kuramitsu, S, RIKEN Structural Genomics/Proteomics Initiative (RSGI) | Deposit date: | 2008-02-15 | Release date: | 2008-07-29 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | Crystal structure of a putative DNA methylase TTHA0409 from Thermus thermophilus HB8 Proteins, 73, 2008
|
|
2ZIF
![Download](https://newweb-cs.pages.dev/newweb/media/icons/dl.png) ![Visualize](https://newweb-cs.pages.dev/newweb/media/icons/hoh_3d.png)
![BU of 2zif by Molmil](/molmil-images/mine/2zif) | Crystal Structure of TTHA0409, Putative DNA Modification Methylase from Thermus thermophilus HB8- Complexed with S-Adenosyl-L-Methionine | Descriptor: | Putative modification methylase, S-ADENOSYLMETHIONINE | Authors: | Morita, R, Ishikawa, H, Nakagawa, N, Masui, R, Yokoyama, S, Kuramitsu, S, RIKEN Structural Genomics/Proteomics Initiative (RSGI) | Deposit date: | 2008-02-15 | Release date: | 2008-07-29 | Last modified: | 2023-11-01 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Crystal structure of a putative DNA methylase TTHA0409 from Thermus thermophilus HB8 Proteins, 73, 2008
|
|
2ZIG
![Download](https://newweb-cs.pages.dev/newweb/media/icons/dl.png) ![Visualize](https://newweb-cs.pages.dev/newweb/media/icons/hoh_3d.png)
![BU of 2zig by Molmil](/molmil-images/mine/2zig) | Crystal Structure of TTHA0409, Putative DNA Modification Methylase from Thermus thermophilus HB8 | Descriptor: | Putative modification methylase | Authors: | Morita, R, Ishikawa, H, Nakagawa, N, Masui, R, Yokoyama, S, Kuramitsu, S, RIKEN Structural Genomics/Proteomics Initiative (RSGI) | Deposit date: | 2008-02-15 | Release date: | 2008-07-29 | Last modified: | 2023-11-01 | Method: | X-RAY DIFFRACTION (2.1 Å) | Cite: | Crystal structure of a putative DNA methylase TTHA0409 from Thermus thermophilus HB8 Proteins, 73, 2008
|
|
1NW7
![Download](https://newweb-cs.pages.dev/newweb/media/icons/dl.png) ![Visualize](https://newweb-cs.pages.dev/newweb/media/icons/hoh_3d.png)
![BU of 1nw7 by Molmil](/molmil-images/mine/1nw7) | Structure of the beta class N6-adenine DNA methyltransferase RsrI bound to S-ADENOSYL-L-HOMOCYSTEINE | Descriptor: | CHLORIDE ION, MODIFICATION METHYLASE RSRI, S-ADENOSYL-L-HOMOCYSTEINE | Authors: | Thomas, C.B, Scavetta, R.D, Gumport, R.I, Churchill, M.E.A. | Deposit date: | 2003-02-05 | Release date: | 2003-07-29 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (2.1 Å) | Cite: | Structures of liganded and unliganded RsrI N6-adenine DNA methyltransferase: a distinct orientation for active cofactor binding J.Biol.Chem., 278, 2003
|
|
1NW5
![Download](https://newweb-cs.pages.dev/newweb/media/icons/dl.png) ![Visualize](https://newweb-cs.pages.dev/newweb/media/icons/hoh_3d.png)
![BU of 1nw5 by Molmil](/molmil-images/mine/1nw5) | Structure of the beta class N6-adenine DNA methyltransferase RsrI bound to S-ADENOSYLMETHIONINE | Descriptor: | CHLORIDE ION, MODIFICATION METHYLASE RSRI, S-ADENOSYLMETHIONINE | Authors: | Thomas, C.B, Scavetta, R.D, Gumport, R.I, Churchill, M.E.A. | Deposit date: | 2003-02-05 | Release date: | 2003-07-29 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (2.05 Å) | Cite: | Structures of liganded and unliganded RsrI N6-adenine DNA methyltransferase: a distinct orientation for active cofactor binding J.Biol.Chem., 278, 2003
|
|
1NW6
![Download](https://newweb-cs.pages.dev/newweb/media/icons/dl.png) ![Visualize](https://newweb-cs.pages.dev/newweb/media/icons/hoh_3d.png)
![BU of 1nw6 by Molmil](/molmil-images/mine/1nw6) | Structure of the beta class N6-adenine DNA methyltransferase RsrI bound to sinefungin | Descriptor: | CHLORIDE ION, MODIFICATION METHYLASE RSRI, SINEFUNGIN | Authors: | Thomas, C.B, Scavetta, R.D, Gumport, R.I, Churchill, M.E.A. | Deposit date: | 2003-02-05 | Release date: | 2003-07-29 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (1.94 Å) | Cite: | Structures of liganded and unliganded RsrI N6-adenine DNA methyltransferase: a distinct orientation for active cofactor binding J.Biol.Chem., 278, 2003
|
|
1NW8
![Download](https://newweb-cs.pages.dev/newweb/media/icons/dl.png) ![Visualize](https://newweb-cs.pages.dev/newweb/media/icons/hoh_3d.png)
![BU of 1nw8 by Molmil](/molmil-images/mine/1nw8) | Structure of L72P mutant beta class N6-adenine DNA methyltransferase RsrI | Descriptor: | CHLORIDE ION, MODIFICATION METHYLASE RSRI | Authors: | Thomas, C.B, Scavetta, R.D, Gumport, R.I, Churchill, M.E.A. | Deposit date: | 2003-02-05 | Release date: | 2003-07-29 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (2.25 Å) | Cite: | Structures of liganded and unliganded RsrI N6-adenine DNA methyltransferase: a distinct orientation for active cofactor binding J.Biol.Chem., 278, 2003
|
|
6PBD
![Download](https://newweb-cs.pages.dev/newweb/media/icons/dl.png) ![Visualize](https://newweb-cs.pages.dev/newweb/media/icons/hoh_3d.png)
![BU of 6pbd by Molmil](/molmil-images/mine/6pbd) | DNA N6-Adenine Methyltransferase CcrM In Complex with Double-Stranded DNA Oligonucleotide Containing Its Recognition Sequence GAATC | Descriptor: | 1,2-ETHANEDIOL, DNA (5'-D(*CP*GP*AP*TP*TP*CP*AP*AP*TP*GP*AP*AP*TP*CP*CP*CP*AP*AP*G)-3'), DNA (5'-D(*GP*CP*TP*TP*GP*GP*GP*AP*TP*TP*CP*AP*TP*TP*GP*AP*AP*TP*C)-3'), ... | Authors: | Horton, J.R, Cheng, X, Woodcock, C.B. | Deposit date: | 2019-06-13 | Release date: | 2019-10-23 | Last modified: | 2023-10-11 | Method: | X-RAY DIFFRACTION (2.343 Å) | Cite: | The cell cycle-regulated DNA adenine methyltransferase CcrM opens a bubble at its DNA recognition site. Nat Commun, 10, 2019
|
|
4ZCF
![Download](https://newweb-cs.pages.dev/newweb/media/icons/dl.png) ![Visualize](https://newweb-cs.pages.dev/newweb/media/icons/hoh_3d.png)
![BU of 4zcf by Molmil](/molmil-images/mine/4zcf) | Structural basis of asymmetric DNA methylation and ATP-triggered long-range diffusion by EcoP15I | Descriptor: | ADENOSINE MONOPHOSPHATE, CALCIUM ION, DNA 20-mer AATCATAGTCTACTGCTGTA, ... | Authors: | Gupta, Y.K, Chan, S.H, Xu, S.Y, Aggarwal, A.K. | Deposit date: | 2015-04-15 | Release date: | 2015-07-29 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Structural basis of asymmetric DNA methylation and ATP-triggered long-range diffusion by EcoP15I. Nat Commun, 6, 2015
|
|