PDB: 19129 resultsInfo pagesStatus searchChemie searchBIRD

---

5H5M	Crystal structure of HMP-1 M domain Descriptor: Alpha-catenin-like protein hmp-1 Authors: Kang, H, Bang, I, Weis, W.I, Choi, H.J. Deposit date: 2016-11-08 Release date: 2017-03-29 Last modified: 2024-05-29 Method: X-RAY DIFFRACTION (2.4 Å) Cite: Structural and functional characterization of Caenorhabditis elegans alpha-catenin reveals constitutive binding to beta-catenin and F-actin J. Biol. Chem., 292, 2017
1Q5A	S-shaped trans interactions of cadherins model based on fitting C-cadherin (1L3W) to 3D map of desmosomes obtained by electron tomography Descriptor: 2-acetamido-2-deoxy-alpha-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose, CALCIUM ION, ... Authors: He, W, Cowin, P, Stokes, D.L. Deposit date: 2003-08-06 Release date: 2003-10-07 Last modified: 2020-07-29 Method: ELECTRON MICROSCOPY (30 Å) Cite: Untangling Desmosomal Knots with Electron Tomography Science, 302, 2003
2AIN	Solution structure of the AF-6 PDZ domain complexed with the C-terminal peptide from the Bcr protein Descriptor: 6-mer peptide from Breakpoint cluster region protein, Afadin Authors: Chen, Q, Wu, J, Shi, Y. Deposit date: 2005-07-30 Release date: 2006-07-18 Last modified: 2024-05-29 Method: SOLUTION NMR Cite: Solution structure and backbone dynamics of the AF-6 PDZ domain/Bcr peptide complex. Protein Sci., 16, 2007
2FX2	COMPARISON OF THE CRYSTAL STRUCTURES OF A FLAVODOXIN IN ITS THREE OXIDATION STATES AT CRYOGENIC TEMPERATURES Descriptor: FLAVIN MONONUCLEOTIDE, FLAVODOXIN Authors: Watt, W, Watenpaugh, K.D. Deposit date: 1991-10-17 Release date: 1993-10-31 Last modified: 2024-02-14 Method: X-RAY DIFFRACTION (1.9 Å) Cite: Comparison of the crystal structures of a flavodoxin in its three oxidation states at cryogenic temperatures. J.Mol.Biol., 218, 1991
9ICD	CATALYTIC MECHANISM OF NADP+-DEPENDENT ISOCITRATE DEHYDROGENASE: IMPLICATIONS FROM THE STRUCTURES OF MAGNESIUM-ISOCITRATE AND NADP+ COMPLEXES Descriptor: ISOCITRATE DEHYDROGENASE, NADP NICOTINAMIDE-ADENINE-DINUCLEOTIDE PHOSPHATE Authors: Hurley, J.H, Dean, A.M, Koshland Jr, D.E, Stroud, R.M. Deposit date: 1991-07-29 Release date: 1991-10-15 Last modified: 2024-02-14 Method: X-RAY DIFFRACTION (2.5 Å) Cite: Catalytic mechanism of NADP(+)-dependent isocitrate dehydrogenase: implications from the structures of magnesium-isocitrate and NADP+ complexes. Biochemistry, 30, 1991
4UT1	The structure of the flagellar hook junction protein FlgK from Burkholderia pseudomallei Descriptor: 1,2-ETHANEDIOL, FLAGELLAR HOOK-ASSOCIATED PROTEIN Authors: Gourlay, L.J, Lassaux, P, Bolognesi, M. Deposit date: 2014-07-17 Release date: 2015-02-11 Last modified: 2024-05-08 Method: X-RAY DIFFRACTION (1.8 Å) Cite: From Crystal Structure to in Silico Epitope Discovery in Burkholderia Pseudomallei Flagellar Hook-Associated Protein Flgk. FEBS J., 282, 2015
4URP	The Crystal structure of Nitroreductase from Saccharomyces cerevisiae Descriptor: FATTY ACID REPRESSION MUTANT PROTEIN 2 Authors: Song, H.-N, Woo, E.-J, Bang, S.-Y, Jung, D.-G, Park, S.-G. Deposit date: 2014-07-01 Release date: 2015-04-29 Last modified: 2024-05-08 Method: X-RAY DIFFRACTION (2.991 Å) Cite: Crystal Structure of the Fungal Nitroreductase Frm2 from Saccharomyces Cerevisiae. Protein Sci., 24, 2015
4WF6	Anthrax toxin lethal factor with bound small molecule inhibitor MK-31 Descriptor: 1,2-ETHANEDIOL, Lethal factor, N~2~-[(4-fluoro-3-methylphenyl)sulfonyl]-N-hydroxy-D-alaninamide, ... Authors: Maize, K.M, De la Mora-Rey, T, Finzel, B.C. Deposit date: 2014-09-12 Release date: 2015-09-09 Last modified: 2023-09-27 Method: X-RAY DIFFRACTION (2.6521 Å) Cite: Probing the S2' Subsite of the Anthrax Toxin Lethal Factor Using Novel N-Alkylated Hydroxamates. J.Med.Chem., 58, 2015
3EX7	The crystal structure of EJC in its transition state Descriptor: ADENOSINE-5'-DIPHOSPHATE, ALUMINUM FLUORIDE, Eukaryotic initiation factor 4A-III, ... Authors: Andersen, G.R, Nielsen, K.H. Deposit date: 2008-10-16 Release date: 2008-12-09 Last modified: 2023-11-01 Method: X-RAY DIFFRACTION (2.301 Å) Cite: Mechanism of ATP turnover inhibition in the EJC Rna, 15, 2009
3HHN	Crystal structure of class I ligase ribozyme self-ligation product, in complex with U1A RBD Descriptor: Class I ligase ribozyme, self-ligation product, MAGNESIUM ION, ... Authors: Shechner, D.M, Grant, R.A, Bagby, S.C, Bartel, D.P. Deposit date: 2009-05-15 Release date: 2009-11-24 Last modified: 2024-02-21 Method: X-RAY DIFFRACTION (2.987 Å) Cite: Crystal structure of the catalytic core of an RNA-polymerase ribozyme. Science, 326, 2009
7PNE	Parallel Q-D hybrid with 3' duplex stem-loop as a lateral snapback loop Descriptor: TTAMycdup-3sbl Authors: Vianney, Y.M, Weisz, K. Deposit date: 2021-09-06 Release date: 2021-12-29 Last modified: 2024-06-19 Method: SOLUTION NMR Cite: Indoloquinoline Ligands Favor Intercalation at Quadruplex-Duplex Interfaces. Chemistry, 28, 2022
7PNG	Solution structure of 1:1 complex of an indoloquinoline derivative SYUIQ-5 to parallel quadruplex-duplex (Q-D) hybrid Descriptor: DNA (37-MER), ~{N}-(5~{H}-indolo[3,2-b]quinolin-11-yl)-~{N}',~{N}'-dimethyl-propane-1,3-diamine Authors: Vianney, Y.M, Weisz, K. Deposit date: 2021-09-06 Release date: 2021-12-29 Last modified: 2024-06-19 Method: SOLUTION NMR Cite: Indoloquinoline Ligands Favor Intercalation at Quadruplex-Duplex Interfaces. Chemistry, 28, 2022
4Q2Q	ZO1 PDZ3 in Complex with a Phage-Derived Peptide Descriptor: Tight junction protein ZO-1 Authors: Appleton, B.A, Wiesmann, C. Deposit date: 2014-04-09 Release date: 2014-09-10 Last modified: 2023-09-20 Method: X-RAY DIFFRACTION (1.45 Å) Cite: A structural portrait of the PDZ domain family. J.Mol.Biol., 426, 2014
1FLR	4-4-20 FAB FRAGMENT Descriptor: 2-(6-HYDROXY-3-OXO-3H-XANTHEN-9-YL)-BENZOIC ACID, 4-4-20 (IG*G2A=KAPPA=) FAB FRAGMENT Authors: Whitlow, M. Deposit date: 1995-01-19 Release date: 1995-09-15 Last modified: 2024-06-05 Method: X-RAY DIFFRACTION (1.85 Å) Cite: 1.85 A structure of anti-fluorescein 4-4-20 Fab. Protein Eng., 8, 1995
1FDB	CRYSTAL STRUCTURES OF OXIDIZED AND REDUCED AZOTOBACTER VINELANDII FERREDOXIN AT PH 8 AND PH 6 Descriptor: FE3-S4 CLUSTER, FERREDOXIN, IRON/SULFUR CLUSTER Authors: Stout, C.D. Deposit date: 1993-06-29 Release date: 1993-10-31 Last modified: 2024-02-07 Method: X-RAY DIFFRACTION (2.2 Å) Cite: Crystal structures of oxidized and reduced Azotobacter vinelandii ferredoxin at pH 8 and 6. J.Biol.Chem., 268, 1993
1FDA	CRYSTAL STRUCTURES OF OXIDIZED AND REDUCED AZOTOBACTER VINELANDII FERREDOXIN AT PH 8 AND PH 6 Descriptor: FE3-S4 CLUSTER, FERREDOXIN, IRON/SULFUR CLUSTER Authors: Stout, C.D. Deposit date: 1993-06-29 Release date: 1993-10-31 Last modified: 2024-02-07 Method: X-RAY DIFFRACTION (2.1 Å) Cite: Crystal structures of oxidized and reduced Azotobacter vinelandii ferredoxin at pH 8 and 6. J.Biol.Chem., 268, 1993
1FDD	AZOTOBACTER VINELANDII FERREDOXIN I: ASPARTATE 15 FACILITATES PROTON TRANSFER TO THE REDUCED [3FE-4S] CLUSTER Descriptor: FE3-S4 CLUSTER, FERREDOXIN, IRON/SULFUR CLUSTER Authors: Stout, C.D. Deposit date: 1993-01-17 Release date: 1993-10-31 Last modified: 2024-02-07 Method: X-RAY DIFFRACTION (1.9 Å) Cite: Azotobacter vinelandii ferredoxin I. Aspartate 15 facilitates proton transfer to the reduced [3Fe-4S] cluster. J.Biol.Chem., 268, 1993
1FD2	SITE-DIRECTED MUTAGENESIS OF AZOTOBACTER VINELANDII FERREDOXIN I. (FE-S) CLUSTER-DRIVEN PROTEIN REARRANGEMENT Descriptor: FE3-S4 CLUSTER, FERREDOXIN, IRON/SULFUR CLUSTER Authors: Stout, C.D. Deposit date: 1988-12-08 Release date: 1989-10-15 Last modified: 2024-02-07 Method: X-RAY DIFFRACTION (1.9 Å) Cite: Site-directed mutagenesis of Azotobacter vinelandii ferredoxin I: [Fe-S] cluster-driven protein rearrangement. Proc.Natl.Acad.Sci.USA, 87, 1990
1GPR	REFINED CRYSTAL STRUCTURE OF IIA DOMAIN OF THE GLUCOSE PERMEASE OF BACILLUS SUBTILIS AT 1.9 ANGSTROMS RESOLUTION Descriptor: GLUCOSE PERMEASE Authors: Liao, D.-I, Herzberg, O. Deposit date: 1991-09-25 Release date: 1993-10-31 Last modified: 2024-02-07 Method: X-RAY DIFFRACTION (1.9 Å) Cite: An atomic model for protein-protein phosphoryl group transfer. J.Biol.Chem., 267, 1992
4P0P	Crystal structure of Human Mus81-Eme1 in complex with 5'-flap DNA, and Mg2+ Descriptor: Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCTCAATC, ... Authors: Gwon, G.H, Baek, K, Cho, Y. Deposit date: 2014-02-22 Release date: 2014-05-28 Last modified: 2023-12-27 Method: X-RAY DIFFRACTION (2.8 Å) Cite: Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates. Embo J., 33, 2014
4P0Q	Crystal structure of Human Mus81-Eme1 in complex with 5'-flap DNA Descriptor: Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCTCAATC, ... Authors: Gwon, G.H, Baek, K, Cho, Y. Deposit date: 2014-02-22 Release date: 2014-05-28 Last modified: 2023-12-27 Method: X-RAY DIFFRACTION (2.851 Å) Cite: Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates. Embo J., 33, 2014
4P0S	human Mus81-Eme1-3'flap DNA complex Descriptor: Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCT, ... Authors: Gwon, G.H, Baek, K, Cho, Y. Deposit date: 2014-02-22 Release date: 2014-05-28 Last modified: 2023-12-27 Method: X-RAY DIFFRACTION (6 Å) Cite: Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates. Embo J., 33, 2014
4P0R	human Mus81-Eme1-3'flap DNA complex Descriptor: Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA ACGTGCTTACACACAGAGGTTAGGGTGAACTT, ... Authors: Gwon, G.H, Baek, K, Cho, Y. Deposit date: 2014-02-22 Release date: 2014-05-28 Last modified: 2023-12-27 Method: X-RAY DIFFRACTION (6.501 Å) Cite: Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates. Embo J., 33, 2014
5A6C	Concomitant binding of Afadin to LGN and F-actin directs planar spindle orientation Descriptor: G-PROTEIN-SIGNALING MODULATOR 2, AFADIN, SULFATE ION Authors: Carminati, M, Gallini, S, Pirovano, L, Alfieri, A, Bisi, S, Mapelli, M. Deposit date: 2015-06-25 Release date: 2015-12-30 Last modified: 2024-01-10 Method: X-RAY DIFFRACTION (2.901 Å) Cite: Concomitant Binding of Afadin to Lgn and F-Actin Directs Planar Spindle Orientation. Nat.Struct.Mol.Biol., 23, 2016
9F9A	Crystal structure of MUS81-EME1 bound by compound 12. Descriptor: 2-naphthalen-2-yl-5-oxidanyl-6-oxidanylidene-1H-pyrimidine-4-carboxylic acid, Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, ... Authors: Collie, G.W. Deposit date: 2024-05-07 Release date: 2024-06-19 Method: X-RAY DIFFRACTION (2.911 Å) Cite: Fragment-Based Discovery of Novel MUS81 Inhibitors Acs Med.Chem.Lett., 2024

<112113114115116117118119120121122123124125126127>