PDB: 222415 resultsInfo pagesStatus searchChemie searchBIRD

---

1ZIM	GCN4-LEUCINE ZIPPER CORE MUTANT ASN16GLN IN THE TRIMERIC STATE Descriptor: GENERAL CONTROL PROTEIN GCN4 Authors: Gonzalez Junior, L, Woolfson, D.N, Alber, T. Deposit date: 1996-10-30 Release date: 1997-07-07 Last modified: 2021-11-03 Method: X-RAY DIFFRACTION (2 Å) Cite: Buried polar residues and structural specificity in the GCN4 leucine zipper. Nat.Struct.Biol., 3, 1996
1ZII	GCN4-LEUCINE ZIPPER CORE MUTANT ASN16ABA IN THE DIMERIC STATE Descriptor: GENERAL CONTROL PROTEIN GCN4 Authors: Gonzalez Junior, L, Brown, R.A, Richardson, D, Alber, T. Deposit date: 1996-10-30 Release date: 1997-07-07 Last modified: 2024-06-05 Method: X-RAY DIFFRACTION (1.8 Å) Cite: Crystal structures of a single coiled-coil peptide in two oligomeric states reveal the basis for structural polymorphism Nat.Struct.Biol., 3, 1996
1ZIJ	GCN4-LEUCINE ZIPPER CORE MUTANT ASN16ABA IN THE TRIMERIC STATE Descriptor: GENERAL CONTROL PROTEIN GCN4 Authors: Gonzalez Junior, L, Brown, R.A, Richardson, D, Alber, T. Deposit date: 1996-10-30 Release date: 1997-07-07 Last modified: 2024-06-05 Method: X-RAY DIFFRACTION (2 Å) Cite: Crystal structures of a single coiled-coil peptide in two oligomeric states reveal the basis for structural polymorphism Nat.Struct.Biol., 3, 1996
1HA1	HNRNP A1 (RBD1,2) FROM HOMO SAPIENS Descriptor: HNRNP A1 Authors: Shamoo, Y, Krueger, U, Rice, L, Williams, K.R, Steitz, T.A. Deposit date: 1996-10-30 Release date: 1997-05-15 Last modified: 2024-02-07 Method: X-RAY DIFFRACTION (1.75 Å) Cite: Crystal structure of the two RNA binding domains of human hnRNP A1 at 1.75 A resolution. Nat.Struct.Biol., 4, 1997
294D	INTERCALATED CYTOSINE MOTIF AND NOVEL ADENINE CLUSTERS IN THE CRYSTAL STRUCTURE OF TETRAHYMENA TELOMERE Descriptor: DNA (5'-D(*AP*AP*CP*CP*CP*C)-3') Authors: Cai, L, Chen, L, Raghavan, S, Ratliff, R, Moyzis, R, Rich, A. Deposit date: 1996-10-30 Release date: 1998-10-19 Last modified: 2024-02-14 Method: X-RAY DIFFRACTION (2.5 Å) Cite: Intercalated cytosine motif and novel adenine clusters in the crystal structure of the Tetrahymena telomere. Nucleic Acids Res., 26, 1998
1TAL	ALPHA-LYTIC PROTEASE AT 120 K (SINGLE STRUCTURE MODEL) Descriptor: ALPHA-LYTIC PROTEASE, SULFATE ION, TRIS(HYDROXYETHYL)AMINOMETHANE Authors: Rader, S.D, Agard, D.A. Deposit date: 1996-10-30 Release date: 1997-04-01 Last modified: 2011-07-13 Method: X-RAY DIFFRACTION (1.5 Å) Cite: Conformational substates in enzyme mechanism: the 120 K structure of alpha-lytic protease at 1.5 A resolution. Protein Sci., 6, 1997
2ARA	APO FORM OF ESCHERICHIA COLI REGULATORY PROTEIN ARAC Descriptor: ARAC Authors: Soisson, S.M, Wolberger, C. Deposit date: 1996-10-30 Release date: 1997-05-15 Last modified: 2024-05-22 Method: X-RAY DIFFRACTION (2.8 Å) Cite: Structural basis for ligand-regulated oligomerization of AraC. Science, 276, 1997
1OLD	NMR STRUCTURE OF 24-MER DEOXYRIBONUCLEIC ACID, 7 STRUCTURES Descriptor: ARGININEAMIDE, DNA (GATCGAAACGTAGCGCCTTCGATC) Authors: Lin, C.H, Patel, D.J. Deposit date: 1996-10-31 Release date: 1997-04-21 Last modified: 2024-05-22 Method: SOLUTION NMR Cite: Encapsulating an amino acid in a DNA fold. Nat.Struct.Biol., 3, 1996
1RBO	SPINACH RUBISCO IN COMPLEX WITH THE INHIBITOR 2-CARBOXYARABINITOL-1,5-DIPHOSPHATE Descriptor: 2-CARBOXYARABINITOL-1,5-DIPHOSPHATE, RIBULOSE BISPHOSPHATE CARBOXYLASE/OXYGENASE Authors: Taylor, T.C, Andersson, I. Deposit date: 1996-10-31 Release date: 1997-03-12 Last modified: 2018-10-03 Method: X-RAY DIFFRACTION (2.3 Å) Cite: A common structural basis for the inhibition of ribulose 1,5-bisphosphate carboxylase by 4-carboxyarabinitol 1,5-bisphosphate and xylulose 1,5-bisphosphate. J.Biol.Chem., 271, 1996
1ODD	OMPR C-TERMINAL DOMAIN (OMPR-C) FROM ESCHERICHIA COLI Descriptor: TRANSCRIPTIONAL REGULATORY PROTEIN OMPR Authors: Kondou, H, Nakagawa, A, Tanaka, I. Deposit date: 1996-10-31 Release date: 1997-05-15 Last modified: 2024-02-14 Method: X-RAY DIFFRACTION (2.2 Å) Cite: Escherichia coli positive regulator OmpR has a large loop structure at the putative RNA polymerase interaction site. Nat.Struct.Biol., 4, 1997
1RCO	SPINACH RUBISCO IN COMPLEX WITH THE INHIBITOR D-XYLULOSE-2,2-DIOL-1,5-BISPHOSPHATE Descriptor: D-XYLULOSE-2,2-DIOL-1,5-BISPHOSPHATE, RIBULOSE BISPHOSPHATE CARBOXYLASE/OXYGENASE Authors: Taylor, T.C, Andersson, I. Deposit date: 1996-10-31 Release date: 1997-03-12 Last modified: 2023-08-09 Method: X-RAY DIFFRACTION (2.3 Å) Cite: A common structural basis for the inhibition of ribulose 1,5-bisphosphate carboxylase by 4-carboxyarabinitol 1,5-bisphosphate and xylulose 1,5-bisphosphate. J.Biol.Chem., 271, 1996
2AAC	ESCHERCHIA COLI GENE REGULATORY PROTEIN ARAC COMPLEXED WITH D-FUCOSE Descriptor: ACETIC ACID, ARAC, beta-D-fucopyranose Authors: Soisson, S.M, Wolberger, C. Deposit date: 1996-10-31 Release date: 1997-11-12 Last modified: 2024-05-22 Method: X-RAY DIFFRACTION (1.6 Å) Cite: The 1.6 A crystal structure of the AraC sugar-binding and dimerization domain complexed with D-fucose. J.Mol.Biol., 273, 1997
1DMP	STRUCTURE OF HIV-1 PROTEASE COMPLEX Descriptor: HIV-1 PROTEASE, [4-R-(-4-ALPHA,5-ALPHA,6-BETA,7-BETA)]-HEXAHYDRO-5,6-BIS(HYDROXY)-1,3-BIS([(3-AMINO)PHENYL]METHYL)-4,7-BIS(PHENYLMETHYL)-2H-1,3-DIAZEPINONE Authors: Chang, C.-H. Deposit date: 1996-11-01 Release date: 1997-11-12 Last modified: 2023-08-09 Method: X-RAY DIFFRACTION (2 Å) Cite: Improved cyclic urea inhibitors of the HIV-1 protease: synthesis, potency, resistance profile, human pharmacokinetics and X-ray crystal structure of DMP 450. Chem.Biol., 3, 1996
1PUP	CRYSTAL STRUCTURE OF A PEPTIDE NUCLEIC ACID (PNA) DUPLEX AT 1.7 ANGSTROMS RESOLUTION Descriptor: PNA (H-P(*CPN*GPN*TPN*APN*CPN*GPN)-NH2) Authors: Rasmussen, H, Kastrup, J.S. Deposit date: 1996-11-01 Release date: 1997-02-25 Last modified: 2023-11-15 Method: X-RAY DIFFRACTION (1.7 Å) Cite: Crystal structure of a peptide nucleic acid (PNA) duplex at 1.7 A resolution. Nat.Struct.Biol., 4, 1997
1RE7	DIHYDROFOLATE REDUCTASE COMPLEXED WITH FOLATE Descriptor: DIHYDROFOLATE REDUCTASE, FOLIC ACID Authors: Sawaya, M.R. Deposit date: 1996-11-01 Release date: 1996-12-23 Last modified: 2024-05-22 Method: X-RAY DIFFRACTION (2.6 Å) Cite: Loop and subdomain movements in the mechanism of Escherichia coli dihydrofolate reductase: crystallographic evidence. Biochemistry, 36, 1997
1RD7	DIHYDROFOLATE REDUCTASE COMPLEXED WITH FOLATE Descriptor: BETA-MERCAPTOETHANOL, DIHYDROFOLATE REDUCTASE, FOLIC ACID Authors: Sawaya, M.R, Kraut, J. Deposit date: 1996-11-01 Release date: 1996-12-23 Last modified: 2023-08-09 Method: X-RAY DIFFRACTION (2.6 Å) Cite: Loop and subdomain movements in the mechanism of Escherichia coli dihydrofolate reductase: crystallographic evidence. Biochemistry, 36, 1997
1BAY	GLUTATHIONE S-TRANSFERASE YFYF CYS 47-CARBOXYMETHYLATED CLASS PI, FREE ENZYME Descriptor: GLUTATHIONE S-TRANSFERASE CLASS PI Authors: Vega, M.C, Coll, M. Deposit date: 1996-11-02 Release date: 1997-11-12 Last modified: 2024-05-22 Method: X-RAY DIFFRACTION (2 Å) Cite: The three-dimensional structure of Cys-47-modified mouse liver glutathione S-transferase P1-1. Carboxymethylation dramatically decreases the affinity for glutathione and is associated with a loss of electron density in the alphaB-310B region. J.Biol.Chem., 273, 1998
1LTW	RECOMBINANT SPERM WHALE MYOGLOBIN 29W MUTANT (OXY) Descriptor: MYOGLOBIN, OXYGEN MOLECULE, PROTOPORPHYRIN IX CONTAINING FE, ... Authors: Li, T, Olson, J.S, Phillips Jr, G.N. Deposit date: 1996-11-02 Release date: 1996-12-23 Last modified: 2024-02-14 Method: X-RAY DIFFRACTION (1.7 Å) Cite: Perturbation of the Fe-O2 Bond by Nearby Residues in Heme Pocket: Observation of Vfe-O2 Raman Bands for Oxymyoglobin Mutants J.Am.Chem.Soc., 118, 1996
1AXH	ATRACOTOXIN-HVI FROM HADRONYCHE VERSUTA (AUSTRALIAN FUNNEL-WEB SPIDER, NMR, 20 STRUCTURES Descriptor: ATRACOTOXIN-HVI Authors: Fletcher, J.I, O'Donoghue, S.I, Nilges, M, King, G.F. Deposit date: 1996-11-04 Release date: 1997-11-12 Last modified: 2021-02-03 Method: SOLUTION NMR Cite: The structure of a novel insecticidal neurotoxin, omega-atracotoxin-HV1, from the venom of an Australian funnel web spider. Nat.Struct.Biol., 4, 1997
1TBD	SOLUTION STRUCTURE OF THE ORIGIN DNA BINDING DOMAIN OF SV40 T-ANTIGEN, NMR, MINIMIZED AVERAGE STRUCTURE Descriptor: SV40 T-ANTIGEN Authors: Luo, X, Sanford, D.G, Bullock, P.A, Bachovchin, W.W. Deposit date: 1996-11-04 Release date: 1997-03-12 Last modified: 2024-05-22 Method: SOLUTION NMR Cite: Solution structure of the origin DNA-binding domain of SV40 T-antigen. Nat.Struct.Biol., 3, 1996
1UDR	CHEY MUTANT WITH LYS 91 REPLACED BY ASP, LYS 92 REPLACED BY ALA, ILE 96 REPLACED BY LYS AND ALA 98 REPLACED BY LEU (STABILIZING MUTATIONS IN HELIX 4) Descriptor: CHEY PROTEIN Authors: Parraga, A, Coll, M. Deposit date: 1996-11-05 Release date: 1997-11-19 Last modified: 2024-05-22 Method: X-RAY DIFFRACTION (1.9 Å) Cite: Towards understanding a molecular switch mechanism: thermodynamic and crystallographic studies of the signal transduction protein CheY. J.Mol.Biol., 303, 2000
1TVX	NEUTROPHIL ACTIVATING PEPTIDE-2 VARIANT FORM M6L WITH FIVE ADDITIONAL AMINO TERMINAL RESIDUES (DSDLY) Descriptor: NEUTROPHIL ACTIVATING PEPTIDE 2 VARIANT Authors: Malkowski, M.G, Edwards, B.F.P. Deposit date: 1996-11-05 Release date: 1997-01-11 Last modified: 2023-08-09 Method: X-RAY DIFFRACTION (1.75 Å) Cite: The amino-terminal residues in the crystal structure of connective tissue activating peptide-III (des10) block the ELR chemotactic sequence. J.Mol.Biol., 266, 1997
1ULL	RNA APTAMER COMPLEXED WITH HIV-1 REV PEPTIDE, NMR, 7 STRUCTURES Descriptor: REV PEPTIDE, RNA (5'-R (GP*GP*CP*UP*GP*GP*AP*CP*UP*CP*GP*UP*AP*CP*UP*UP*CP*GP* GP*UP*AP*CP*UP*GP*GP*AP*GP*AP*AP*AP*CP*AP*GP*CP*C)-3') Authors: Ye, X, Gorin, A, Ellington, A.D, Patel, D.J. Deposit date: 1996-11-05 Release date: 1997-08-20 Last modified: 2024-05-22 Method: SOLUTION NMR Cite: Deep penetration of an alpha-helix into a widened RNA major groove in the HIV-1 rev peptide-RNA aptamer complex. Nat.Struct.Biol., 3, 1996
1LRV	A LEUCINE-RICH REPEAT VARIANT WITH A NOVEL REPETITIVE PROTEIN STRUCTURAL MOTIF Descriptor: LEUCINE-RICH REPEAT VARIANT Authors: Peters, J.W, Stowell, M.H.B, Rees, D.C. Deposit date: 1996-11-05 Release date: 1997-03-12 Last modified: 2024-02-14 Method: X-RAY DIFFRACTION (2.6 Å) Cite: A leucine-rich repeat variant with a novel repetitive protein structural motif. Nat.Struct.Biol., 3, 1996
1AI1	HIV-1 V3 LOOP MIMIC Descriptor: AIB142, IGG1-KAPPA 59.1 FAB (HEAVY CHAIN), IGG1-KAPPA 59.1 FAB (LIGHT CHAIN) Authors: Ghiara, J.B, Wilson, I.A. Deposit date: 1996-11-06 Release date: 1997-05-15 Last modified: 2023-08-02 Method: X-RAY DIFFRACTION (2.8 Å) Cite: Structure-based design of a constrained peptide mimic of the HIV-1 V3 loop neutralization site. J.Mol.Biol., 266, 1997

<221222223224225226227228229230231232233234235236>