4ZCF
 
 | | Structural basis of asymmetric DNA methylation and ATP-triggered long-range diffusion by EcoP15I | | Descriptor: | ADENOSINE MONOPHOSPHATE, CALCIUM ION, DNA 20-mer AATCATAGTCTACTGCTGTA, ... | | Authors: | Gupta, Y.K, Chan, S.H, Xu, S.Y, Aggarwal, A.K. | | Deposit date: | 2015-04-15 | | Release date: | 2015-07-29 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Structural basis of asymmetric DNA methylation and ATP-triggered long-range diffusion by EcoP15I.
Nat Commun, 6, 2015
|
|
