1FV7
 
 | | A TWO B-Z JUNCTION CONTAINING DNA RESOLVES INTO AN ALL RIGHT HANDED DOUBLE HELIX | | Descriptor: | 5'-D(*(5CM)P*GP*(5CM)P*GP*(0DC)P*(0DG)P*(5CM)P*GP*(5CM)P*G)-3' | | Authors: | Mauffret, O, El Amri, C, Santamaria, F, Tevanian, G, Rayner, B, Fermandjian, S. | | Deposit date: | 2000-09-19 | | Release date: | 2000-10-11 | | Last modified: | 2024-05-01 | | Method: | SOLUTION NMR | | Cite: | A two B-Z junction containing DNA resolves into an all right-handed double-helix.
Nucleic Acids Res., 28, 2000
|
|
2X6D
 | | Aurora-A bound to an inhibitor | | Descriptor: | 6-BROMO-7-[4-(4-CHLOROBENZYL)PIPERAZIN-1-YL]-2-[4-(MORPHOLIN-4-YLMETHYL)PHENYL]-3H-IMIDAZO[4,5-B]PYRIDINE, SERINE/THREONINE-PROTEIN KINASE 6, SULFATE ION | | Authors: | Kosmopoulou, M, Bayliss, R. | | Deposit date: | 2010-02-17 | | Release date: | 2010-07-07 | | Last modified: | 2023-12-20 | | Method: | X-RAY DIFFRACTION (2.796 Å) | | Cite: | Imidazo[4,5-b]pyridine derivatives as inhibitors of Aurora kinases: lead optimization studies toward the identification of an orally bioavailable preclinical development candidate.
J. Med. Chem., 53, 2010
|
|
4GGL
 | | Pyrrolopyrimidine inhibitors of dna gyrase b and topoisomerase iv, part i: structure guided discovery and optimization of dual targeting agents with potent, broad-spectrum enzymatic activity | | Descriptor: | 7-({4-[(3R)-3-aminopyrrolidin-1-yl]-5-chloro-6-ethyl-7H-pyrrolo[2,3-d]pyrimidin-2-yl}sulfanyl)pyrido[2,3-b]pyrazin-2(1H)-one, DNA gyrase subunit B, GLYCEROL | | Authors: | Bensen, D.C, Creighton, C.J, Tari, L.W. | | Deposit date: | 2012-08-06 | | Release date: | 2013-02-13 | | Last modified: | 2024-02-28 | | Method: | X-RAY DIFFRACTION (1.69 Å) | | Cite: | Pyrrolopyrimidine inhibitors of DNA gyrase B (GyrB) and topoisomerase IV (ParE). Part I: Structure guided discovery and optimization of dual targeting agents with potent, broad-spectrum enzymatic activity.
Bioorg.Med.Chem.Lett., 23, 2013
|
|
1YHT
 | | Crystal structure analysis of Dispersin B | | Descriptor: | ACETIC ACID, DspB, GLYCEROL | | Authors: | Ramasubbu, N, Thomas, L.M, Ragunath, C, Kaplan, J.B. | | Deposit date: | 2005-01-10 | | Release date: | 2006-01-10 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Structural Analysis of Dispersin B, a Biofilm-releasing Glycoside Hydrolase from the Periodontopathogen Actinobacillus actinomycetemcomitans.
J.Mol.Biol., 349, 2005
|
|
1XH4
 | | Crystal Structures of Protein Kinase B Selective Inhibitors in Complex with Protein Kinase A and Mutants | | Descriptor: | N-[4-({4-[5-(DIMETHYLAMINO)-2-HYDROXYBENZOYL]BENZOYL}AMINO)AZEPAN-3-YL]ISONICOTINAMIDE, cAMP-dependent protein kinase inhibitor, alpha form, ... | | Authors: | Breitenlechner, C.B, Friebe, W.-G, Brunet, E, Werner, G, Graul, K, Thomas, U, Kuenkele, K.-P, Schaefer, W, Gassel, M, Bossemeyer, D, Huber, R, Engh, R.A, Masjost, B. | | Deposit date: | 2004-09-17 | | Release date: | 2005-09-17 | | Last modified: | 2024-06-26 | | Method: | X-RAY DIFFRACTION (2.45 Å) | | Cite: | Design and crystal structures of protein kinase B-selective inhibitors in complex with protein kinase A and mutants
J.Med.Chem., 48, 2005
|
|
4GPB
 | |
4HWY
 | | Trypanosoma brucei procathepsin B solved from 40 fs free-electron laser pulse data by serial femtosecond X-ray crystallography | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, Cysteine peptidase C (CPC), beta-D-mannopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose | | Authors: | Redecke, L, Nass, K, DePonte, D.P, White, T.A, Rehders, D, Barty, A, Stellato, F, Liang, M, Barends, T.R.M, Boutet, S, Williams, G.W, Messerschmidt, M, Seibert, M.M, Aquila, A, Arnlund, D, Bajt, S, Barth, T, Bogan, M.J, Caleman, C, Chao, T.-C, Doak, R.B, Fleckenstein, H, Frank, M, Fromme, R, Galli, L, Grotjohann, I, Hunter, M.S, Johansson, L.C, Kassemeyer, S, Katona, G, Kirian, R.A, Koopmann, R, Kupitz, C, Lomb, L, Martin, A.V, Mogk, S, Neutze, R, Shoemann, R.L, Steinbrener, J, Timneanu, N, Wang, D, Weierstall, U, Zatsepin, N.A, Spence, J.C.H, Fromme, P, Schlichting, I, Duszenko, M, Betzel, C, Chapman, H. | | Deposit date: | 2012-11-09 | | Release date: | 2012-12-05 | | Last modified: | 2023-09-20 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Natively inhibited Trypanosoma brucei cathepsin B structure determined by using an X-ray laser.
Science, 339, 2013
|
|
2R76
 | | Crystal structure of the rare lipoprotein B (SO_1173) from Shewanella oneidensis, Northeast Structural Genomics Consortium Target SoR91A | | Descriptor: | Rare lipoprotein B | | Authors: | Forouhar, F, Chen, Y, Seetharaman, J, Mao, L, Maglaqui, M, Owen, L.A, Cunningham, K, Fang, Y, Xiao, R, Baran, M.C, Acton, T.B, Montelione, G.T, Hunt, J.F, Tong, L, Northeast Structural Genomics Consortium (NESG) | | Deposit date: | 2007-09-07 | | Release date: | 2007-09-25 | | Last modified: | 2017-10-25 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Crystal structure of the rare lipoprotein B (SO_1173) from Shewanella oneidensis.
To be Published
|
|
2X6E
 | | Aurora-A bound to an inhibitor | | Descriptor: | 6-BROMO-7-{4-[(5-METHYLISOXAZOL-3-YL)METHYL]PIPERAZIN-1-YL}-2-[4-(4-METHYLPIPERAZIN-1-YL)PHENYL]-1H-IMIDAZO[4,5-B]PYRIDINE, SERINE/THREONINE-PROTEIN KINASE 6 | | Authors: | Kosmopoulou, M, Bayliss, R. | | Deposit date: | 2010-02-17 | | Release date: | 2010-07-07 | | Last modified: | 2023-12-20 | | Method: | X-RAY DIFFRACTION (3.35 Å) | | Cite: | Imidazo[4,5-b]pyridine derivatives as inhibitors of Aurora kinases: lead optimization studies toward the identification of an orally bioavailable preclinical development candidate.
J. Med. Chem., 53, 2010
|
|
3EX9
 | |
2JC3
 | | Structure of O-Acetylserine Sulfhydrylase B from Salmonella Typhimurium | | Descriptor: | O-ACETYLSERINE SULFHYDRYLASE B, PYRIDOXAL-5'-PHOSPHATE | | Authors: | Chattopadhyay, A, Rabeh, W.M, Speroni, F, Meier, M, Ivaninskii, S, Mozzarelli, A, Burkhard, P, Cook, P.F. | | Deposit date: | 2006-12-19 | | Release date: | 2007-01-23 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Structure, Mechanism, and Conformational Dynamics of O-Acetylserine Sulfhydrylase from Salmonella Typhimurium: Comparison of a and B Isozymes.
Biochemistry, 46, 2007
|
|
1ZYS
 | | Co-crystal structure of Checkpoint Kinase Chk1 with a pyrrolo-pyridine inhibitor | | Descriptor: | N-{5-[4-(4-METHYLPIPERAZIN-1-YL)PHENYL]-1H-PYRROLO[2,3-B]PYRIDIN-3-YL}NICOTINAMIDE, SULFATE ION, Serine/threonine-protein kinase Chk1, ... | | Authors: | Stavenger, R.A, Zhao, B, Zhou, B.-B.S, Brown, M.J, Lee, D, Holt, D.A. | | Deposit date: | 2005-06-10 | | Release date: | 2006-06-13 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (1.7 Å) | | Cite: | Pyrrolo[2,3-b]pyridines Inhibit the Checkpoint Kinase Chk1
To be Published
|
|
3EID
 | | CDK2/CyclinA complexed with a pyrazolopyridazine inhibitor | | Descriptor: | (2S)-1-(dimethylamino)-3-(4-{[4-(6-morpholin-4-ylpyrazolo[1,5-b]pyridazin-3-yl)pyrimidin-2-yl]amino}phenoxy)propan-2-ol, Cell division protein kinase 2, Cyclin-A2 | | Authors: | Steven, K, Reno, M, Alberti, J, Price, D, Kane-Carson, L, Knick, V, Shewchuk, L, Hassell, A, Veal, J, Peel, M. | | Deposit date: | 2008-09-15 | | Release date: | 2008-10-21 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (3.15 Å) | | Cite: | Synthesis and evaluation of pyrazolo[1,5-b]pyridazines as selective cyclin dependent kinase inhibitors.
Bioorg.Med.Chem.Lett., 18, 2008
|
|
1EA2
 | | Pseudoreversion of the Catalytic Activity of Y14F by the Additional Tyrosine-to-Phenylalanine Substitution(s) in the Hydrogen Bond Network of Delta-5-3-Ketosteroid Isomerase from Pheudomonas putida Biotype B | | Descriptor: | STEROID DELTA-ISOMERASE | | Authors: | Choi, G, Ha, N.-C, Kim, M.-S, Hong, B.-H, Choi, K.Y. | | Deposit date: | 2000-11-03 | | Release date: | 2001-11-01 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Pseudoreversion of the Catalytic Activity of Y14F by the Additional Substitution(S) of Tyrosine with Phenylalanine in the Hydrogen Bond Network of Delta (5)-3-Ketosteroid Isomerase from Pseudomonas Putida Biotype B
Biochemistry, 40, 2001
|
|
4O3Y
 | | Crystal structure of the vaccine antigen Transferrin Binding Protein B (TbpB) mutant Arg-179-Glu from Actinobacillus pleuropneumoniae H87 | | Descriptor: | ACETATE ION, GLYCEROL, Outer membrane protein; transferrin-binding protein | | Authors: | Calmettes, C, Yu, R.H, Schryvers, A.B, Moraes, T.F. | | Deposit date: | 2013-12-18 | | Release date: | 2015-01-14 | | Last modified: | 2015-03-04 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Nonbinding site-directed mutants of transferrin binding protein B exhibit enhanced immunogenicity and protective capabilities.
Infect.Immun., 83, 2015
|
|
1JSX
 | |
4O4U
 | | Crystal structure of the vaccine antigen Transferrin Binding Protein B (TbpB) mutant Trp-176-Ala from Haemophilus parasuis Hp5 | | Descriptor: | GLYCEROL, TbpB | | Authors: | Calmettes, C, Yu, R.H, Schryvers, A.B, Moraes, T.F. | | Deposit date: | 2013-12-19 | | Release date: | 2015-01-14 | | Last modified: | 2015-03-04 | | Method: | X-RAY DIFFRACTION (2.64 Å) | | Cite: | Nonbinding site-directed mutants of transferrin binding protein B exhibit enhanced immunogenicity and protective capabilities.
Infect.Immun., 83, 2015
|
|
4O49
 | | Crystal structure of the vaccine antigen Transferrin Binding Protein B (TbpB) mutant Tyr-174-Ala from Actinobacillus pleuropneumoniae H87 | | Descriptor: | ACETATE ION, GLYCEROL, Outer membrane protein; transferrin-binding protein | | Authors: | Calmettes, C, Yu, R.H, Schryvers, A.B, Moraes, T.F. | | Deposit date: | 2013-12-18 | | Release date: | 2015-01-14 | | Last modified: | 2015-03-04 | | Method: | X-RAY DIFFRACTION (2.5 Å) | | Cite: | Nonbinding site-directed mutants of transferrin binding protein B exhibit enhanced immunogenicity and protective capabilities.
Infect.Immun., 83, 2015
|
|
1R7W
 | | NMR STRUCTURE OF THE R(GGAGGACAUCCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUCCCU BULGE | | Descriptor: | 34-MER | | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | | Deposit date: | 2003-10-22 | | Release date: | 2004-05-25 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,).
Biochemistry, 43, 2004
|
|
1R7Z
 | | NMR STRUCTURE OF THE R(GGAGGACAUUCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUUCCU BULGE | | Descriptor: | 34-MER | | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | | Deposit date: | 2003-10-22 | | Release date: | 2004-05-25 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,).
Biochemistry, 43, 2004
|
|
3AI8
 | | Cathepsin B in complex with the nitroxoline | | Descriptor: | 5-nitroquinolin-8-ol, Cathepsin B | | Authors: | Renko, M, Mirkovic, B, Gobec, S, Kos, J, Turk, D. | | Deposit date: | 2010-05-11 | | Release date: | 2011-05-18 | | Last modified: | 2023-11-01 | | Method: | X-RAY DIFFRACTION (2.11 Å) | | Cite: | Novel mechanism of cathepsin B inhibition by antibiotic nitroxoline and related compounds
Chemmedchem, 6, 2011
|
|
3CVK
 | | Crystal structure of HCV NS5B polymerase with a novel pyridazinone inhibitor | | Descriptor: | N-{3-[1-(3,3-Dimethyl-butyl)-4-hydroxy-2-oxo-1,2,4a,5,6,7-hexahydro-pyrrolo[1,2-b]pyridazin-3-yl]-1,1-dioxo-1,2-dihydro -1lambda6-benzo[1,2,4]thiadiazin-7-yl}-methanesulfonamide, RNA-directed RNA polymerase | | Authors: | Zhao, Q, Showalter, R.E, Han, Q, Kissinger, C.R. | | Deposit date: | 2008-04-18 | | Release date: | 2009-04-21 | | Last modified: | 2024-04-03 | | Method: | X-RAY DIFFRACTION (2.31 Å) | | Cite: | Hexahydro-pyrrolo- and hexahydro-1H-pyrido[1,2-b]pyridazin-2-ones as potent inhibitors of HCV NS5B polymerase.
Bioorg.Med.Chem.Lett., 18, 2008
|
|
2IUJ
 | | Crystal Structure of Soybean Lipoxygenase-B | | Descriptor: | FE (III) ION, LIPOXYGENASE L-5 | | Authors: | Youn, B, Sellhorn, G.E, Mirchel, R.J, Gaffney, B.J, Grimes, H.D, Kang, C. | | Deposit date: | 2006-06-05 | | Release date: | 2006-10-11 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Crystal Structures of Vegetative Soybean Lipoxygenase Vlx-B and Vlx-D, and Comparisons with Seed Isoforms Lox-1 and Lox-3.
Proteins, 65, 2006
|
|
4HXW
 | | Pyrrolopyrimidine inhibitors of dna gyrase b and topoisomerase iv, part i: structure guided discovery and optimization of dual targeting agents with potent, broad-spectrum enzymatic activity. | | Descriptor: | (3R)-1-[5-chloro-6-ethyl-2-(pyrido[2,3-b]pyrazin-7-ylsulfanyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl]pyrrolidin-3-amine, DNA gyrase subunit B, TERTIARY-BUTYL ALCOHOL | | Authors: | Bensen, D.C, Trzoss, M, Tari, L.W. | | Deposit date: | 2012-11-12 | | Release date: | 2013-02-13 | | Last modified: | 2024-02-28 | | Method: | X-RAY DIFFRACTION (1.69 Å) | | Cite: | Pyrrolopyrimidine inhibitors of DNA gyrase B (GyrB) and topoisomerase IV (ParE). Part I: Structure guided discovery and optimization of dual targeting agents with potent, broad-spectrum enzymatic activity.
Bioorg.Med.Chem.Lett., 23, 2013
|
|
3OG7
 | | B-Raf Kinase V600E oncogenic mutant in complex with PLX4032 | | Descriptor: | AKAP9-BRAF fusion protein, N-(3-{[5-(4-chlorophenyl)-1H-pyrrolo[2,3-b]pyridin-3-yl]carbonyl}-2,4-difluorophenyl)propane-1-sulfonamide | | Authors: | Zhang, Y, Zhang, K.Y, Zhang, C. | | Deposit date: | 2010-08-16 | | Release date: | 2010-09-22 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (2.45 Å) | | Cite: | Clinical efficacy of a RAF inhibitor needs broad target blockade in BRAF-mutant melanoma.
Nature, 467, 2010
|
|
