8J0I
 
 | | Aldo-keto reductase KmAKR | | Descriptor: | NADPH-dependent alpha-keto amide reductase, SODIUM ION | | Authors: | Xu, S.Y, Zhou, L, Xu, Y, Wang, Y.J, Zheng, Y.G. | | Deposit date: | 2023-04-11 | | Release date: | 2024-04-17 | | Method: | X-RAY DIFFRACTION (1.91 Å) | | Cite: | Aldo-keto reductase KmAKR from Kluyveromyces marxianus
To Be Published
|
|
8DR9
 | |
8WJW
 | |
8WK9
 | |
8WK5
 | |
8WK7
 | |
8WKA
 | |
8IKU
 | |
8WSQ
 | |
2B5A
 | | C.BclI, Control Element of the BclI Restriction-Modification System | | Descriptor: | ACETIC ACID, C.BclI | | Authors: | Sawaya, M.R, Zhu, Z, Mersha, F, Chan, S.H, Dabur, R, Xu, S.Y, Balendiran, G.K. | | Deposit date: | 2005-09-28 | | Release date: | 2006-01-03 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (1.543 Å) | | Cite: | Crystal Structure of the Restriction-Modification System Control Element C.BclI and Mapping of Its Binding Site.
Structure, 13, 2005
|
|
4ZCF
 | | Structural basis of asymmetric DNA methylation and ATP-triggered long-range diffusion by EcoP15I | | Descriptor: | ADENOSINE MONOPHOSPHATE, CALCIUM ION, DNA 20-mer AATCATAGTCTACTGCTGTA, ... | | Authors: | Gupta, Y.K, Chan, S.H, Xu, S.Y, Aggarwal, A.K. | | Deposit date: | 2015-04-15 | | Release date: | 2015-07-29 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Structural basis of asymmetric DNA methylation and ATP-triggered long-range diffusion by EcoP15I.
Nat Commun, 6, 2015
|
|
1SDO
 | | Crystal Structure of Restriction Endonuclease BstYI | | Descriptor: | BstYI | | Authors: | Townson, S.A, Samuelson, J.C, Vanamee, E.S, Edwards, T.A, Escalante, C.R, Xu, S.Y, Aggarwal, A.K. | | Deposit date: | 2004-02-13 | | Release date: | 2004-05-11 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (1.85 Å) | | Cite: | Crystal Structure of BstYI at 1.85 A Resolution: A Thermophilic Restriction Endonuclease with Overlapping Specificities to BamHI and BglII
J.Mol.Biol., 338, 2004
|
|
2P0J
 | | Structure of restriction endonuclease BstYI bound to non-cognate DNA | | Descriptor: | 5'-D(*AP*TP*GP*AP*AP*TP*CP*CP*AP*TP*A)-3', 5'-D(*TP*AP*TP*GP*GP*AP*TP*TP*CP*AP*T)-3', BstYI | | Authors: | Townson, S.A, Samuelson, J.C, Bao, Y, Xu, S.Y, Aggarwal, A.K. | | Deposit date: | 2007-02-28 | | Release date: | 2007-05-01 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | BstYI Bound to Noncognate DNA Reveals a "Hemispecific" Complex: Implications for DNA Scanning.
Structure, 15, 2007
|
|
1VRR
 | | Crystal structure of the restriction endonuclease BstYI complex with DNA | | Descriptor: | 5'-D(*TP*TP*AP*TP*AP*GP*AP*TP*CP*TP*AP*TP*AP*A)-3', BstYI | | Authors: | Townson, S.A, Samuelson, J.C, Xu, S.Y, Aggarwal, A.K. | | Deposit date: | 2005-06-02 | | Release date: | 2005-06-07 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Implications for Switching Restriction Enzyme Specificities from the Structure of BstYI Bound to a BglII DNA Sequence.
Structure, 13, 2005
|
|
