7DG2
| Nse1-Nse3-Nse4 complex | Descriptor: | ACETATE ION, GLYCEROL, MAGE domain-containing protein, ... | Authors: | Cho, Y, Jo, A. | Deposit date: | 2020-11-10 | Release date: | 2021-05-26 | Last modified: | 2023-11-29 | Method: | X-RAY DIFFRACTION (1.7 Å) | Cite: | Structure Basis for Shaping the Nse4 Protein by the Nse1 and Nse3 Dimer within the Smc5/6 Complex. J.Mol.Biol., 433, 2021
|
|
7F4U
| Cryo-EM structure of TELO2-TTI1-TTI2 complex | Descriptor: | TELO2-interacting protein 1 homolog, TELO2-interacting protein 2, Telomere length regulation protein TEL2 homolog | Authors: | Cho, Y, Kim, Y. | Deposit date: | 2021-06-21 | Release date: | 2022-06-22 | Last modified: | 2024-06-12 | Method: | ELECTRON MICROSCOPY (4.2 Å) | Cite: | Structure of the Human TELO2-TTI1-TTI2 Complex. J.Mol.Biol., 434, 2022
|
|
4P0P
| Crystal structure of Human Mus81-Eme1 in complex with 5'-flap DNA, and Mg2+ | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCTCAATC, ... | Authors: | Gwon, G.H, Baek, K, Cho, Y. | Deposit date: | 2014-02-22 | Release date: | 2014-05-28 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates. Embo J., 33, 2014
|
|
4P0Q
| Crystal structure of Human Mus81-Eme1 in complex with 5'-flap DNA | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCTCAATC, ... | Authors: | Gwon, G.H, Baek, K, Cho, Y. | Deposit date: | 2014-02-22 | Release date: | 2014-05-28 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (2.851 Å) | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates. Embo J., 33, 2014
|
|
4P0S
| human Mus81-Eme1-3'flap DNA complex | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCT, ... | Authors: | Gwon, G.H, Baek, K, Cho, Y. | Deposit date: | 2014-02-22 | Release date: | 2014-05-28 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (6 Å) | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates. Embo J., 33, 2014
|
|
5F3W
| Structure of the ATPrS-Mre11/Rad50-DNA complex | Descriptor: | 27-MER DNA, DNA double-strand break repair Rad50 ATPase,DNA double-strand break repair Rad50 ATPase, DNA double-strand break repair protein Mre11, ... | Authors: | Liu, Y. | Deposit date: | 2015-12-03 | Release date: | 2016-03-02 | Last modified: | 2024-03-20 | Method: | X-RAY DIFFRACTION (3.11 Å) | Cite: | ATP-dependent DNA binding, unwinding, and resection by the Mre11/Rad50 complex Embo J., 35, 2016
|
|
4P0R
| human Mus81-Eme1-3'flap DNA complex | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA ACGTGCTTACACACAGAGGTTAGGGTGAACTT, ... | Authors: | Gwon, G.H, Baek, K, Cho, Y. | Deposit date: | 2014-02-22 | Release date: | 2014-05-28 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (6.501 Å) | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates. Embo J., 33, 2014
|
|
4R89
| Crystal structure of paFAN1 - 5' flap DNA complex with Manganase | Descriptor: | DNA (5'-D(P*AP*CP*CP*AP*GP*AP*CP*AP*CP*AP*CP*AP*TP*TP*C)-3'), DNA (5'-D(P*GP*AP*AP*TP*GP*TP*GP*TP*GP*TP*CP*TP*CP*AP*AP*TP*CP*CP*CP*AP*AP*C)-3'), DNA (5'-D(P*GP*TP*TP*GP*GP*GP*AP*TP*TP*G)-3'), ... | Authors: | Cho, Y, Gwon, G.H, Kim, Y.R. | Deposit date: | 2014-08-30 | Release date: | 2014-10-29 | Last modified: | 2024-03-20 | Method: | X-RAY DIFFRACTION (4.002 Å) | Cite: | Crystal structure of a Fanconi anemia-associated nuclease homolog bound to 5' flap DNA: basis of interstrand cross-link repair by FAN1 Genes Dev., 28, 2014
|
|
4R8A
| Crystal structure of paFAN1 - 5' flap DNA complex | Descriptor: | DNA (5'-D(P*AP*CP*CP*AP*GP*AP*CP*AP*CP*AP*CP*AP*TP*TP*C)-3'), DNA (5'-D(P*GP*AP*AP*TP*GP*TP*GP*TP*GP*TP*CP*TP*CP*AP*AP*TP*CP*CP*CP*AP*A)-3'), DNA (5'-D(P*GP*TP*TP*GP*GP*GP*AP*TP*TP*G)-3'), ... | Authors: | Cho, Y, Gwon, G.H, Kim, Y.R. | Deposit date: | 2014-08-30 | Release date: | 2014-10-29 | Last modified: | 2024-03-20 | Method: | X-RAY DIFFRACTION (3.2 Å) | Cite: | Crystal structure of a Fanconi anemia-associated nuclease homolog bound to 5' flap DNA: basis of interstrand cross-link repair by FAN1 Genes Dev., 28, 2014
|
|
5DNY
| Structure of the ATPrS-Mre11/Rad50-DNA complex | Descriptor: | DNA (27-MER), DNA double-strand break repair Rad50 ATPase,DNA double-strand break repair Rad50 ATPase, DNA double-strand break repair protein Mre11, ... | Authors: | Liu, Y. | Deposit date: | 2015-09-10 | Release date: | 2016-02-24 | Last modified: | 2024-03-20 | Method: | X-RAY DIFFRACTION (3.11 Å) | Cite: | ATP-dependent DNA binding, unwinding, and resection by the Mre11/Rad50 complex. Embo J., 35, 2016
|
|