4P0R
 
 | human Mus81-Eme1-3'flap DNA complex | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA ACGTGCTTACACACAGAGGTTAGGGTGAACTT, ... | Authors: | Gwon, G.H, Baek, K, Cho, Y. | Deposit date: | 2014-02-22 | Release date: | 2014-05-28 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (6.501 Å) | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates. Embo J., 33, 2014
|
|
4P0Q
 
 | Crystal structure of Human Mus81-Eme1 in complex with 5'-flap DNA | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCTCAATC, ... | Authors: | Gwon, G.H, Baek, K, Cho, Y. | Deposit date: | 2014-02-22 | Release date: | 2014-05-28 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (2.851 Å) | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates. Embo J., 33, 2014
|
|
4P0S
 
 | human Mus81-Eme1-3'flap DNA complex | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCT, ... | Authors: | Gwon, G.H, Baek, K, Cho, Y. | Deposit date: | 2014-02-22 | Release date: | 2014-05-28 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (6 Å) | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates. Embo J., 33, 2014
|
|
4P0P
 
 | Crystal structure of Human Mus81-Eme1 in complex with 5'-flap DNA, and Mg2+ | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCTCAATC, ... | Authors: | Gwon, G.H, Baek, K, Cho, Y. | Deposit date: | 2014-02-22 | Release date: | 2014-05-28 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates. Embo J., 33, 2014
|
|
4R89
 
 | Crystal structure of paFAN1 - 5' flap DNA complex with Manganase | Descriptor: | DNA (5'-D(P*AP*CP*CP*AP*GP*AP*CP*AP*CP*AP*CP*AP*TP*TP*C)-3'), DNA (5'-D(P*GP*AP*AP*TP*GP*TP*GP*TP*GP*TP*CP*TP*CP*AP*AP*TP*CP*CP*CP*AP*AP*C)-3'), DNA (5'-D(P*GP*TP*TP*GP*GP*GP*AP*TP*TP*G)-3'), ... | Authors: | Cho, Y, Gwon, G.H, Kim, Y.R. | Deposit date: | 2014-08-30 | Release date: | 2014-10-29 | Last modified: | 2024-03-20 | Method: | X-RAY DIFFRACTION (4.002 Å) | Cite: | Crystal structure of a Fanconi anemia-associated nuclease homolog bound to 5' flap DNA: basis of interstrand cross-link repair by FAN1 Genes Dev., 28, 2014
|
|
4R8A
 
 | Crystal structure of paFAN1 - 5' flap DNA complex | Descriptor: | DNA (5'-D(P*AP*CP*CP*AP*GP*AP*CP*AP*CP*AP*CP*AP*TP*TP*C)-3'), DNA (5'-D(P*GP*AP*AP*TP*GP*TP*GP*TP*GP*TP*CP*TP*CP*AP*AP*TP*CP*CP*CP*AP*A)-3'), DNA (5'-D(P*GP*TP*TP*GP*GP*GP*AP*TP*TP*G)-3'), ... | Authors: | Cho, Y, Gwon, G.H, Kim, Y.R. | Deposit date: | 2014-08-30 | Release date: | 2014-10-29 | Last modified: | 2024-03-20 | Method: | X-RAY DIFFRACTION (3.2 Å) | Cite: | Crystal structure of a Fanconi anemia-associated nuclease homolog bound to 5' flap DNA: basis of interstrand cross-link repair by FAN1 Genes Dev., 28, 2014
|
|
4TUM
 
 | Crystal structure of Ankyrin Repeat Domain of AKR2 | Descriptor: | Ankyrin repeat domain-containing protein 2 | Authors: | Gwon, G.H, Cho, Y. | Deposit date: | 2014-06-24 | Release date: | 2014-09-24 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | An Ankyrin Repeat Domain of AKR2 Drives Chloroplast Targeting through Coincident Binding of Two Chloroplast Lipids. Dev.Cell, 30, 2014
|
|
3AV0
 
 | Crystal structure of Mre11-Rad50 bound to ATP S | Descriptor: | DNA double-strand break repair protein mre11, DNA double-strand break repair rad50 ATPase, GLYCEROL, ... | Authors: | Lim, H.S, Kim, J.S, Cho, Y. | Deposit date: | 2011-02-18 | Release date: | 2011-05-25 | Last modified: | 2023-11-01 | Method: | X-RAY DIFFRACTION (3.1 Å) | Cite: | Crystal Structure of the Mre11-Rad50-ATP S Complex: Understanding the Interplay between Mre11 and Rad50 To be Published
|
|
3AUY
 
 | Crystal structure of Rad50 bound to ADP | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, DNA double-strand break repair rad50 ATPase, MAGNESIUM ION | Authors: | Lim, H.S, Cho, Y. | Deposit date: | 2011-02-18 | Release date: | 2011-05-25 | Last modified: | 2024-10-30 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | Crystal Structure of the Mre11-Rad50-ATP S Complex: Understanding the Interplay between Mre11 and Rad50 To be Published
|
|
3AUZ
 
 | Crystal structure of Mre11 with manganese | Descriptor: | DNA double-strand break repair protein mre11, GLYCEROL, MANGANESE (II) ION | Authors: | Park, Y.B, Cho, Y. | Deposit date: | 2011-02-18 | Release date: | 2011-05-25 | Last modified: | 2023-11-01 | Method: | X-RAY DIFFRACTION (3.206 Å) | Cite: | Crystal Structure of the Mre11-Rad50-ATP S Complex: Understanding the Interplay between Mre11 and Rad50 To be Published
|
|
3AUX
 
 | Crystal structure of Rad50 bound to ADP | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, DNA double-strand break repair rad50 ATPase, MAGNESIUM ION | Authors: | Lim, H.S, Cho, Y. | Deposit date: | 2011-02-17 | Release date: | 2011-05-25 | Last modified: | 2023-11-01 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | Crystal Structure of the Mre11-Rad50-ATP S Complex:Understanding the Interplay between Mre11 and Rad50 To be Published
|
|