1R7W
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1r7w by Molmil](/molmil-images/mine/1r7w) | NMR STRUCTURE OF THE R(GGAGGACAUCCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUCCCU BULGE | Descriptor: | 34-MER | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | Deposit date: | 2003-10-22 | Release date: | 2004-05-25 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,). Biochemistry, 43, 2004
|
|
1SLS
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1sls by Molmil](/molmil-images/mine/1sls) | IMMOBILE SLIPPED-LOOP STRUCTURE (SLS) OF DNA HOMODIMER IN SOLUTION, NMR, 9 STRUCTURES | Descriptor: | OLIGODEOXYRIBONUCLEOTIDE | Authors: | Ulyanov, N.B, Ivanov, V.I, Minyat, E.E, Khomyakova, E.B, Petrova, M.V, Lesiak, K, James, T.L. | Deposit date: | 1997-09-30 | Release date: | 1998-04-08 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | A pseudosquare knot structure of DNA in solution. Biochemistry, 37, 1998
|
|
1SKP
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1skp by Molmil](/molmil-images/mine/1skp) | NMR STRUCTURE OF D(GCATATGATAG)(DOT)D(CTATCATATGC): A CONSENSUS SEQUENCE FOR PROMOTERS RECOGNIZED BY SIGMA-K RNA POLYMERASE, 4 STRUCTURES | Descriptor: | SIGMA-K RNA POLYMERASE CONSENSUS SEQUENCE | Authors: | Tonelli, M, Ragg, E, Bianucci, A.M, Lesiak, K, James, T.L. | Deposit date: | 1998-05-20 | Release date: | 1999-01-13 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | Nuclear magnetic resonance structure of d(GCATATGATAG). d(CTATCATATGC): a consensus sequence for promoters recognized by sigma K RNA polymerase. Biochemistry, 37, 1998
|
|
1ROQ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1roq by Molmil](/molmil-images/mine/1roq) | |
1TXS
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1txs by Molmil](/molmil-images/mine/1txs) | STEM-LOOP D OF THE CLOVERLEAF DOMAIN OF ENTEROVIRAL 5'UTR RNA | Descriptor: | Enteroviral 5'-UTR | Authors: | Du, Z, Yu, J, Ulyanov, N.B, Andino, R, James, T.L. | Deposit date: | 2004-07-06 | Release date: | 2004-10-05 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | Solution Structure of a Consensus Stem-Loop D RNA Domain that Plays Important Roles in Regulating Translation and Replication in Enteroviruses and Rhinoviruses Biochemistry, 43, 2004
|
|
1KOS
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kos by Molmil](/molmil-images/mine/1kos) | SOLUTION NMR STRUCTURE OF AN ANALOG OF THE YEAST TRNA PHE T STEM LOOP CONTAINING RIBOTHYMIDINE AT ITS NATURALLY OCCURRING POSITION | Descriptor: | 5'-R(*CP*UP*GP*UP*GP*(5MU)P*UP*CP*GP*AP*UP*(CH)P*CP*AP*CP*AP*G)- 3' | Authors: | Koshlap, K.M, Guenther, R, Sochacka, E, Malkiewicz, A, Agris, P.F. | Deposit date: | 1999-05-03 | Release date: | 1999-10-22 | Last modified: | 2023-12-27 | Method: | SOLUTION NMR | Cite: | A distinctive RNA fold: the solution structure of an analogue of the yeast tRNAPhe T Psi C domain. Biochemistry, 38, 1999
|
|