6C3R
| |
1ROQ
| |
1TXS
| STEM-LOOP D OF THE CLOVERLEAF DOMAIN OF ENTEROVIRAL 5'UTR RNA | Descriptor: | Enteroviral 5'-UTR | Authors: | Du, Z, Yu, J, Ulyanov, N.B, Andino, R, James, T.L. | Deposit date: | 2004-07-06 | Release date: | 2004-10-05 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | Solution Structure of a Consensus Stem-Loop D RNA Domain that Plays Important Roles in Regulating Translation and Replication in Enteroviruses and Rhinoviruses Biochemistry, 43, 2004
|
|
8E31
| Purification of Enterovirus A71, strain 4643, WT capsid | Descriptor: | Genome polyprotein, VP1, VP3 | Authors: | Catching, A, Capponi, S, Andino, R. | Deposit date: | 2022-08-16 | Release date: | 2023-08-30 | Last modified: | 2023-12-06 | Method: | ELECTRON MICROSCOPY (14 Å) | Cite: | A tradeoff between enterovirus A71 particle stability and cell entry. Nat Commun, 14, 2023
|
|
8E2Y
| Purification of Enterovirus A71, strain 4643, WT capsid | Descriptor: | Genome polyprotein, VP1, VP2 | Authors: | Catching, A, Capponi, S, Andino, R. | Deposit date: | 2022-08-16 | Release date: | 2023-08-30 | Last modified: | 2023-12-06 | Method: | ELECTRON MICROSCOPY (8 Å) | Cite: | A tradeoff between enterovirus A71 particle stability and cell entry. Nat Commun, 14, 2023
|
|
8E3B
| Purification of Enterovirus A71, strain 4643, WT capsid | Descriptor: | VP1, VP2, VP3 | Authors: | Catching, A, Capponi, S, Andino, R. | Deposit date: | 2022-08-16 | Release date: | 2023-08-30 | Last modified: | 2023-12-06 | Method: | ELECTRON MICROSCOPY (5.9 Å) | Cite: | A tradeoff between enterovirus A71 particle stability and cell entry. Nat Commun, 14, 2023
|
|
8E2X
| Purification of Enterovirus A71, strain 4643, WT capsid | Descriptor: | SPHINGOSINE, VP1, VP2, ... | Authors: | Catching, A, Capponi, S, Andino, R. | Deposit date: | 2022-08-16 | Release date: | 2023-08-30 | Last modified: | 2023-12-06 | Method: | ELECTRON MICROSCOPY (3.3 Å) | Cite: | A tradeoff between enterovirus A71 particle stability and cell entry. Nat Commun, 14, 2023
|
|
8E39
| Purification of Enterovirus A71, strain 4643, WT capsid | Descriptor: | SPHINGOSINE, VP1, VP2, ... | Authors: | Catching, A, Capponi, S, Andino, R. | Deposit date: | 2022-08-16 | Release date: | 2023-08-30 | Last modified: | 2023-12-06 | Method: | ELECTRON MICROSCOPY (3.1 Å) | Cite: | A tradeoff between enterovirus A71 particle stability and cell entry. Nat Commun, 14, 2023
|
|
8E3C
| Purification of Enterovirus A71, strain 4643, WT capsid | Descriptor: | VP1, VP2, VP3 | Authors: | Catching, A, Capponi, S, Andino, R. | Deposit date: | 2022-08-16 | Release date: | 2023-08-30 | Last modified: | 2023-12-06 | Method: | ELECTRON MICROSCOPY (7.1 Å) | Cite: | A tradeoff between enterovirus A71 particle stability and cell entry. Nat Commun, 14, 2023
|
|
8E38
| Purification of Enterovirus A71, strain 4643, WT capsid | Descriptor: | SPHINGOSINE, VP1, VP2, ... | Authors: | Catching, A, Capponi, S, Andino, R. | Deposit date: | 2022-08-16 | Release date: | 2023-08-30 | Last modified: | 2023-12-06 | Method: | ELECTRON MICROSCOPY (4.2 Å) | Cite: | A tradeoff between enterovirus A71 particle stability and cell entry. Nat Commun, 14, 2023
|
|
8E3A
| Purification of Enterovirus A71, strain 4643, WT capsid | Descriptor: | VP1, VP2, VP3, ... | Authors: | Catching, A, Capponi, S, Andino, R. | Deposit date: | 2022-08-16 | Release date: | 2023-08-30 | Last modified: | 2023-12-06 | Method: | ELECTRON MICROSCOPY (7.4 Å) | Cite: | A tradeoff between enterovirus A71 particle stability and cell entry. Nat Commun, 14, 2023
|
|
1R7Z
| NMR STRUCTURE OF THE R(GGAGGACAUUCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUUCCU BULGE | Descriptor: | 34-MER | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | Deposit date: | 2003-10-22 | Release date: | 2004-05-25 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,). Biochemistry, 43, 2004
|
|
1R7W
| NMR STRUCTURE OF THE R(GGAGGACAUCCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUCCCU BULGE | Descriptor: | 34-MER | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | Deposit date: | 2003-10-22 | Release date: | 2004-05-25 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,). Biochemistry, 43, 2004
|
|