6LWK
 
 | | Crystal structure of human NEIL1(P2G, E3Q, R242) bound to duplex DNA containing dihydrouracil (DHU) | | Descriptor: | DNA (5'-D(*CP*GP*TP*CP*CP*AP*(UDH)P*GP*TP*CP*TP*AP*C)-3'), DNA (5'-D(*TP*AP*GP*AP*CP*CP*TP*GP*GP*AP*CP*GP*G)-3'), Endonuclease 8-like 1, ... | | Authors: | Liu, M.H, Zhang, J, Zhu, C.X, Zhang, X.X, Gao, Y.Q, Yi, C.Q. | | Deposit date: | 2020-02-07 | | Release date: | 2021-06-09 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (2.88 Å) | | Cite: | DNA repair glycosylase hNEIL1 triages damaged bases via competing interaction modes.
Nat Commun, 12, 2021
|
|
6LWD
 | | Crystal structure of human NEIL1(P2G, E3Q, R242) bound to duplex DNA containing spiroiminodihydantoin (Sp) | | Descriptor: | DNA (5'-D(*CP*GP*TP*CP*CP*AP*(DSP)P*GP*TP*CP*TP*AP*C)-3'), DNA (5'-D(*TP*AP*GP*AP*CP*CP*TP*GP*GP*AP*CP*GP*G)-3'), Endonuclease 8-like 1, ... | | Authors: | Liu, M.H, Zhang, J, Zhu, C.X, Zhang, X.X, Gao, Y.Q, Yi, C.Q. | | Deposit date: | 2020-02-07 | | Release date: | 2021-06-09 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (2.41 Å) | | Cite: | DNA repair glycosylase hNEIL1 triages damaged bases via competing interaction modes.
Nat Commun, 12, 2021
|
|
6LWP
 | | Crystal structure of human NEIL1(R242, Y244R) bound to duplex DNA containing 2'-fluoro-2'-deoxy-5,6-dihydrouridine | | Descriptor: | DNA (5'-D(*CP*GP*TP*CP*CP*AP*(FDU)P*GP*TP*CP*TP*AP*C)-3'), DNA (5'-D(*TP*AP*GP*AP*CP*CP*TP*GP*GP*AP*CP*GP*G)-3'), Endonuclease 8-like 1, ... | | Authors: | Liu, M.H, Zhang, J, Zhu, C.X, Zhang, X.X, Gao, Y.Q, Yi, C.Q. | | Deposit date: | 2020-02-07 | | Release date: | 2021-06-09 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (2.64 Å) | | Cite: | DNA repair glycosylase hNEIL1 triages damaged bases via competing interaction modes.
Nat Commun, 12, 2021
|
|
6LWH
 | | Crystal structure of human NEIL1(P2G, E3Q, K242) bound to duplex DNA containing dihydrothymine (DHT) | | Descriptor: | DNA (5'-D(*CP*GP*TP*CP*CP*AP*(TDH)P*GP*TP*CP*TP*AP*C)-3'), DNA (5'-D(*TP*AP*GP*AP*CP*CP*TP*GP*GP*AP*CP*GP*G)-3'), Endonuclease 8-like 1, ... | | Authors: | Liu, M.H, Zhang, J, Zhu, C.X, Zhang, X.X, Gao, Y.Q, Yi, C.Q. | | Deposit date: | 2020-02-07 | | Release date: | 2021-06-09 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (2.78 Å) | | Cite: | DNA repair glycosylase hNEIL1 triages damaged bases via competing interaction modes.
Nat Commun, 12, 2021
|
|
6LWL
 | | Crystal structure of human NEIL1(R242) bound to duplex DNA containing 2'-fluoro-2'-deoxy-5,6-dihydrouridine | | Descriptor: | DNA (5'-D(*CP*GP*TP*CP*CP*AP*(FDU)P*GP*TP*CP*TP*AP*C)-3'), DNA (5'-D(*TP*AP*GP*AP*CP*CP*TP*GP*GP*AP*CP*GP*G)-3'), Endonuclease 8-like 1, ... | | Authors: | Liu, M.H, Zhang, J, Zhu, C.X, Zhang, X.X, Gao, Y.Q, Yi, C.Q. | | Deposit date: | 2020-02-07 | | Release date: | 2021-06-09 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (2.55 Å) | | Cite: | DNA repair glycosylase hNEIL1 triages damaged bases via competing interaction modes.
Nat Commun, 12, 2021
|
|
6LWQ
 | | Crystal structure of human NEIL1(R242) bound to duplex DNA containing a C:T mismatch | | Descriptor: | DNA (5'-D(*CP*GP*TP*CP*CP*AP*TP*GP*TP*CP*TP*AP*C)-3'), DNA (5'-D(*TP*AP*GP*AP*CP*CP*TP*GP*GP*AP*CP*GP*G)-3'), Endonuclease 8-like 1 | | Authors: | Liu, M.H, Zhang, J, Zhu, C.X, Zhang, X.X, Gao, Y.Q, Yi, C.Q. | | Deposit date: | 2020-02-07 | | Release date: | 2021-06-09 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (2.89 Å) | | Cite: | DNA repair glycosylase hNEIL1 triages damaged bases via competing interaction modes.
Nat Commun, 12, 2021
|
|
6LWR
 | | Crystal structure of human NEIL1(K242) bound to duplex DNA containing a cleaved C:T mismatch | | Descriptor: | DNA (5'-D(*CP*GP*TP*CP*CP*(PDA))-3'), DNA (5'-D(*TP*AP*GP*AP*CP*CP*TP*GP*GP*AP*CP*GP*G)-3'), Endonuclease 8-like 1 | | Authors: | Liu, M.H, Zhang, J, Zhu, C.X, Zhang, X.X, Gao, Y.Q, Yi, C.Q. | | Deposit date: | 2020-02-07 | | Release date: | 2021-06-09 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (2.9 Å) | | Cite: | DNA repair glycosylase hNEIL1 triages damaged bases via competing interaction modes.
Nat Commun, 12, 2021
|
|
8EO5
 | | Crystal structure of the class A beta-lactamase precursor LRA-5 from an Alaskan soil metagenome at 1.8 Angstrom resolution | | Descriptor: | 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, LRA-5 | | Authors: | Power, P, D'Amico Gonzalez, G, Centron, D, Gutkind, G, Handelsman, J, Klinke, S. | | Deposit date: | 2022-10-02 | | Release date: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Playing beta-Lactamase Evolution: Metagenomic Class A beta-Lactamase LRA-5 is an Inactive Enzyme Capable of Rendering an Active beta-Lactamase by Introduction of Y69Q and V166E Substitutions
to be published
|
|
8HZR
 | | Crystal structure of SARS-Cov-2 main protease S46F mutant in complex with PF07321332 | | Descriptor: | (1R,2S,5S)-N-{(1E,2S)-1-imino-3-[(3S)-2-oxopyrrolidin-3-yl]propan-2-yl}-6,6-dimethyl-3-[3-methyl-N-(trifluoroacetyl)-L-valyl]-3-azabicyclo[3.1.0]hexane-2-carboxamide, 3C-like proteinase nsp5 | | Authors: | Zeng, X.Y, Zhang, J, Li, J. | | Deposit date: | 2023-01-09 | | Release date: | 2024-01-17 | | Method: | X-RAY DIFFRACTION (1.92 Å) | | Cite: | Crystal structure of SARS-Cov-2 main protease
S46F mutant in complex with PF07321332
To Be Published
|
|
8T0M
 | | Proteasome 20S core particle from Pre1-1 Pre4-1 Double mutant | | Descriptor: | Proteasome subunit alpha type-1, Proteasome subunit alpha type-2, Proteasome subunit alpha type-3, ... | | Authors: | Walsh Jr, R.M, Rawson, S, Schnell, H, Velez, B, Hanna, J. | | Deposit date: | 2023-06-01 | | Release date: | 2023-09-06 | | Last modified: | 2023-10-25 | | Method: | ELECTRON MICROSCOPY (2.4 Å) | | Cite: | Structure of the preholoproteasome reveals late steps in proteasome core particle biogenesis.
Nat.Struct.Mol.Biol., 30, 2023
|
|
8T08
 | | Preholo-Proteasome from Pre1-1 Pre4-1 Double Mutant | | Descriptor: | Proteasome assembly chaperone 2, Proteasome chaperone 1, Proteasome maturation factor UMP1, ... | | Authors: | Walsh Jr, R.M, Rawson, S, Schnell, H, Velez, B, Hanna, J. | | Deposit date: | 2023-05-31 | | Release date: | 2023-09-06 | | Last modified: | 2023-10-25 | | Method: | ELECTRON MICROSCOPY (3 Å) | | Cite: | Structure of the preholoproteasome reveals late steps in proteasome core particle biogenesis.
Nat.Struct.Mol.Biol., 30, 2023
|
|
3MEX
 | | Crystal structure of MexR in oxidized state | | Descriptor: | Multidrug resistance operon repressor | | Authors: | Chen, H, Yi, C, Zhang, J, Zhang, W, Yang, C.-G, He, C. | | Deposit date: | 2010-04-01 | | Release date: | 2010-07-28 | | Last modified: | 2023-11-01 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Structural insight into the oxidation-sensing mechanism of the antibiotic resistance of regulator MexR
Embo Rep., 11, 2010
|
|
7DYS
 | |
8IU2
 | | Cryo-EM structure of Long-wave-sensitive opsin 1 | | Descriptor: | Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-2, Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-1, Guanine nucleotide-binding protein G(i) subunit alpha-1, ... | | Authors: | Peng, Q, Cheng, X.Y, Li, J, Lu, Q.Y, Li, Y.Y, Zhang, J. | | Deposit date: | 2023-03-23 | | Release date: | 2024-03-27 | | Method: | ELECTRON MICROSCOPY (3.35 Å) | | Cite: | Cryo-EM structure of Long-wave-sensitive opsin 1
To Be Published
|
|
8IO3
 | | Cryo-EM structure of human HCN3 channel with cilobradine | | Descriptor: | 3-[[(3~{S})-1-[2-(3,4-dimethoxyphenyl)ethyl]piperidin-3-yl]methyl]-7,8-dimethoxy-2,5-dihydro-1~{H}-3-benzazepin-4-one, Potassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel 3 | | Authors: | Yu, B, Lu, Q.Y, Li, J, Zhang, J. | | Deposit date: | 2023-03-10 | | Release date: | 2024-04-10 | | Method: | ELECTRON MICROSCOPY (3.02 Å) | | Cite: | Cryo-EM structure of human HCN3 channel with cilobradine
To Be Published
|
|
8INZ
 | | Cryo-EM structure of human HCN3 channel in apo state | | Descriptor: | 4-[[(2~{S},4~{a}~{R},6~{S},8~{a}~{S})-6-[(4~{S},5~{R})-4-[(2~{S})-butan-2-yl]-5,9-dimethyl-decyl]-4~{a}-methyl-2,3,4,5,6,7,8,8~{a}-octahydro-1~{H}-naphthalen-2-yl]oxy]-4-oxidanylidene-butanoic acid, Potassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel 3 | | Authors: | Yu, B, Lu, Q.Y, Li, J, Zhang, J. | | Deposit date: | 2023-03-10 | | Release date: | 2024-04-10 | | Method: | ELECTRON MICROSCOPY (2.72 Å) | | Cite: | Cryo-EM structure of human HCN3 channel in apo state
To Be Published
|
|
1FG0
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
2H60
 | | Solution Structure of Human Brg1 Bromodomain | | Descriptor: | Probable global transcription activator SNF2L4 | | Authors: | Shen, W, Xu, C, Zhang, J, Wu, J, Shi, Y. | | Deposit date: | 2006-05-30 | | Release date: | 2007-02-13 | | Last modified: | 2024-05-29 | | Method: | SOLUTION NMR | | Cite: | Solution structure of human Brg1 bromodomain and its specific binding to acetylated histone tails
Biochemistry, 46, 2007
|
|
2L89
 | |
2AX5
 | | Solution Structure of Urm1 from Saccharomyces Cerevisiae | | Descriptor: | Hypothetical 11.0 kDa protein in FAA3-MAS3 intergenic region | | Authors: | Xu, J, Huang, H, Zhang, J, Wu, J, Shi, Y. | | Deposit date: | 2005-09-03 | | Release date: | 2006-06-27 | | Last modified: | 2024-05-29 | | Method: | SOLUTION NMR | | Cite: | Solution structure of Urm1 and its implications for the origin of protein modifiers.
Proc.Natl.Acad.Sci.Usa, 103, 2006
|
|
3NFC
 | |
3QYC
 | | Structure of a dimeric anti-HER2 single domain antibody | | Descriptor: | VH domain of IgG molecule | | Authors: | Baral, T.N, Chao, S, Li, S, Tanha, J, Arbabai, M, Wang, S, Zhang, J. | | Deposit date: | 2011-03-03 | | Release date: | 2012-02-08 | | Last modified: | 2014-02-05 | | Method: | X-RAY DIFFRACTION (1.6 Å) | | Cite: | Crystal Structure of a Human Single Domain Antibody Dimer Formed through V(H)-V(H) Non-Covalent Interactions.
Plos One, 7, 2012
|
|
2IA0
 | | Transcriptional Regulatory Protein PF0864 From Pyrococcus Furiosus a Member of the ASNC Family (PF0864) | | Descriptor: | GOLD ION, Putative HTH-type transcriptional regulator PF0864 | | Authors: | Yang, H, Chang, J, Liu, Z.J, Rose, J.P, Wang, B.C, Southeast Collaboratory for Structural Genomics, Southeast Collaboratory for Structural Genomics (SECSG) | | Deposit date: | 2006-09-06 | | Release date: | 2006-10-31 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (2.37 Å) | | Cite: | Crystal Structure of the Transcriptional Regulatory Protein PF0864: an Asnc Family member from Pyrococcus Furiosus
To be Published
|
|
2I7K
 | | Solution Structure of the Bromodomain of Human BRD7 Protein | | Descriptor: | Bromodomain-containing protein 7 | | Authors: | Sun, H, Liu, J, Zhang, J, Huang, H, Wu, J, Shi, Y. | | Deposit date: | 2006-08-31 | | Release date: | 2007-07-10 | | Last modified: | 2024-05-29 | | Method: | SOLUTION NMR | | Cite: | Solution structure of BRD7 bromodomain and its interaction with acetylated peptides from histone H3 and H4
Biochem.Biophys.Res.Commun., 358, 2007
|
|
3ZDB
 | | Structure of E. coli ExoIX in complex with the palindromic 5ov4 DNA oligonucleotide, di-magnesium and potassium | | Descriptor: | 5OV4 DNA, 5'-D(*AP*AP*AP*AP*GP*CP*GP*TP*AP*CP*GP*CP)-3', ACETATE ION, ... | | Authors: | Hemsworth, G.R, Anstey-Gilbert, C.S, Flemming, C.S, Hodskinson, M.R.G, Zhang, J, Sedelnikova, S.E, Stillman, T.J, Sayers, J.R, Artymiuk, P.J. | | Deposit date: | 2012-11-26 | | Release date: | 2013-07-10 | | Last modified: | 2024-05-01 | | Method: | X-RAY DIFFRACTION (1.47 Å) | | Cite: | The Structure of E. Coli Exoix - Implications for DNA Binding and Catalysis in Flap Endonucleases
Nucleic Acids Res., 41, 2013
|
|
