1TS4
| Q139K MUTANT OF TOXIC SHOCK SYNDROME TOXIN-1 FROM S. AUREUS | Descriptor: | TOXIC SHOCK SYNDROME TOXIN-1 | Authors: | Earhart, C.A, Mitchell, D.T, Murray, D.L, Pinheiro, D.M, Matsumura, M, Schlievert, P.M, Ohlendorf, D.H. | Deposit date: | 1997-10-10 | Release date: | 1998-12-16 | Last modified: | 2024-05-22 | Method: | X-RAY DIFFRACTION (3.4 Å) | Cite: | Structures of five mutants of toxic shock syndrome toxin-1 with reduced biological activity. Biochemistry, 37, 1998
|
|
1VOM
| |
1VZV
| STRUCTURE OF VARICELLA-ZOSTER VIRUS PROTEASE | Descriptor: | VARICELLA-ZOSTER VIRUS PROTEASE | Authors: | Qiu, X, Jason, C.A, Culp, J.S, Richardson, S.B, Debouck, C, Smith, W.W, Abdel-Meguid, S.S. | Deposit date: | 1997-02-10 | Release date: | 1998-09-16 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | Crystal structure of varicella-zoster virus protease. Proc.Natl.Acad.Sci.USA, 94, 1997
|
|
1QSL
| |
1Q75
| |
1QCR
| CRYSTAL STRUCTURE OF BOVINE MITOCHONDRIAL CYTOCHROME BC1 COMPLEX, ALPHA CARBON ATOMS ONLY | Descriptor: | PROTOPORPHYRIN IX CONTAINING FE, UBIQUINOL CYTOCHROME C OXIDOREDUCTASE | Authors: | Xia, D, Yu, C.A, Kim, H, Xia, J.Z, Kachurin, A, Zhang, L, Yu, L, Deisenhofer, J. | Deposit date: | 1997-05-17 | Release date: | 1998-10-14 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | Crystal structure of the cytochrome bc1 complex from bovine heart mitochondria. Science, 277, 1997
|
|
1SQP
| Crystal Structure Analysis of Bovine Bc1 with Myxothiazol | Descriptor: | (2Z,6E)-7-{2'-[(2E,4E)-1,6-DIMETHYLHEPTA-2,4-DIENYL]-2,4'-BI-1,3-THIAZOL-4-YL}-3,5-DIMETHOXY-4-METHYLHEPTA-2,6-DIENAMID E, (9R,11S)-9-({[(1S)-1-HYDROXYHEXADECYL]OXY}METHYL)-2,2-DIMETHYL-5,7,10-TRIOXA-2LAMBDA~5~-AZA-6LAMBDA~5~-PHOSPHAOCTACOSANE-6,6,11-TRIOL, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine, ... | Authors: | Esser, L, Quinn, B, Li, Y.F, Zhang, M, Elberry, M, Yu, L, Yu, C.A, Xia, D. | Deposit date: | 2004-03-19 | Release date: | 2005-11-01 | Last modified: | 2023-08-23 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | Crystallographic studies of quinol oxidation site inhibitors: a modified classification of inhibitors for the cytochrome bc(1) complex. J.Mol.Biol., 341, 2004
|
|
1SQQ
| Crystal Structure Analysis of Bovine Bc1 with Methoxy Acrylate Stilbene (MOAS) | Descriptor: | Cytochrome b, Cytochrome c1, heme protein, ... | Authors: | Esser, L, Quinn, B, Li, Y.F, Zhang, M, Elberry, M, Yu, L, Yu, C.A, Xia, D. | Deposit date: | 2004-03-19 | Release date: | 2005-10-25 | Last modified: | 2023-08-23 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | Crystallographic studies of quinol oxidation site inhibitors: a modified classification of inhibitors for the cytochrome bc(1) complex. J.Mol.Biol., 341, 2004
|
|
1SQB
| Crystal Structure Analysis of Bovine Bc1 with Azoxystrobin | Descriptor: | Cytochrome b, Cytochrome c1, heme protein, ... | Authors: | Esser, L, Quinn, B, Li, Y.F, Zhang, M, Elberry, M, Yu, L, Yu, C.A, Xia, D. | Deposit date: | 2004-03-18 | Release date: | 2004-09-07 | Last modified: | 2023-08-23 | Method: | X-RAY DIFFRACTION (2.69 Å) | Cite: | Crystallographic studies of quinol oxidation site inhibitors: a modified classification of inhibitors for the cytochrome bc(1) complex J.Mol.Biol., 341, 2004
|
|
1SQV
| Crystal Structure Analysis of Bovine Bc1 with UHDBT | Descriptor: | 6-HYDROXY-5-UNDECYL-1,3-BENZOTHIAZOLE-4,7-DIONE, Cytochrome b, Cytochrome c1, ... | Authors: | Esser, L, Quinn, B, Li, Y.F, Zhang, M, Elberry, M, Yu, L, Yu, C.A, Xia, D. | Deposit date: | 2004-03-19 | Release date: | 2005-09-06 | Last modified: | 2021-03-03 | Method: | X-RAY DIFFRACTION (2.85 Å) | Cite: | Crystallographic studies of quinol oxidation site inhibitors: a modified classification of inhibitors for the cytochrome bc(1) complex. J.Mol.Biol., 341, 2004
|
|
1SQX
| Crystal Structure Analysis of Bovine Bc1 with Stigmatellin A | Descriptor: | Cytochrome b, Cytochrome c1, heme protein, ... | Authors: | Esser, L, Quinn, B, Li, Y.F, Zhang, M, Elberry, M, Yu, L, Yu, C.A, Xia, D. | Deposit date: | 2004-03-21 | Release date: | 2005-09-06 | Last modified: | 2023-08-23 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Crystallographic studies of quinol oxidation site inhibitors: a modified classification of inhibitors for the cytochrome bc(1) complex. J.Mol.Biol., 341, 2004
|
|
3BIF
| 6-PHOSPHOFRUCTO-2-KINASE/FRUCTOSE-2,6-BISPHOSPHATASE EMPTY 6-PF-2K ACTIVE SITE | Descriptor: | PHOSPHATE ION, PROTEIN (6-PHOSPHOFRUCTO-2-KINASE/ FRUCTOSE-2,6-BISPHOSPHATASE), SUCCINIC ACID, ... | Authors: | Yuen, M.H, Hasemann, C.A. | Deposit date: | 1999-05-05 | Release date: | 1999-09-29 | Last modified: | 2023-08-30 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | A switch in the kinase domain of rat testis 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase. Biochemistry, 38, 1999
|
|
3BIV
| Human thrombin-in complex with UB-THR11 | Descriptor: | (S)-N-(4-carbamimidoylbenzyl)-1-(2-(cyclohexylamino)ethanoyl)pyrrolidine-2-carboxamide, 2-acetamido-2-deoxy-beta-D-glucopyranose, Hirudin, ... | Authors: | Gerlach, C, Smolinski, M, Steuber, H, Sotriffer, C.A, Heine, A, Hangauer, D.G, Klebe, G. | Deposit date: | 2007-12-01 | Release date: | 2007-12-25 | Last modified: | 2023-11-15 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | Thermodynamic Inhibition Profile of a Cyclopentyl and a Cyclohexyl Derivative towards Thrombin: The Same but for Different Reasons Angew.Chem.Int.Ed.Engl., 46, 2007
|
|
3GBQ
| SOLUTION NMR STRUCTURE OF THE GRB2 N-TERMINAL SH3 DOMAIN COMPLEXED WITH A TEN-RESIDUE PEPTIDE DERIVED FROM SOS DIRECT REFINEMENT AGAINST NOES, J-COUPLINGS, AND 1H AND 13C CHEMICAL SHIFTS, MINIMIZED AVERAGE STRUCTURE | Descriptor: | GRB2, SOS-1 | Authors: | Wittekind, M, Mapelli, C, Lee, V, Goldfarb, V, Friedrichs, M.S, Meyers, C.A, Mueller, L. | Deposit date: | 1996-12-23 | Release date: | 1997-09-04 | Last modified: | 2022-03-16 | Method: | SOLUTION NMR | Cite: | Solution structure of the Grb2 N-terminal SH3 domain complexed with a ten-residue peptide derived from SOS: direct refinement against NOEs, J-couplings and 1H and 13C chemical shifts. J.Mol.Biol., 267, 1997
|
|
1JCI
| Stabilization of the Engineered Cation-binding Loop in Cytochrome c Peroxidase (CcP) | Descriptor: | Cytochrome C Peroxidase, POTASSIUM ION, PROTOPORPHYRIN IX CONTAINING FE | Authors: | Bhaskar, B, Bonagura, C.A, Li, H, Poulos, T.L. | Deposit date: | 2001-06-09 | Release date: | 2002-03-06 | Last modified: | 2024-04-03 | Method: | X-RAY DIFFRACTION (1.9 Å) | Cite: | Cation-induced stabilization of the engineered cation-binding loop in cytochrome c peroxidase (CcP). Biochemistry, 41, 2002
|
|
1KX5
| X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution | Descriptor: | CHLORIDE ION, DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (1.94 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
2SEC
| |
2GBQ
| SOLUTION NMR STRUCTURE OF THE GRB2 N-TERMINAL SH3 DOMAIN COMPLEXED WITH A TEN-RESIDUE PEPTIDE DERIVED FROM SOS DIRECT REFINEMENT AGAINST NOES, J-COUPLINGS, AND 1H AND 13C CHEMICAL SHIFTS, 15 STRUCTURES | Descriptor: | GRB2, SOS-1 | Authors: | Wittekind, M, Mapelli, C, Lee, V, Goldfarb, V, Friedrichs, M.S, Meyers, C.A, Mueller, L. | Deposit date: | 1996-12-23 | Release date: | 1997-09-04 | Last modified: | 2022-03-09 | Method: | SOLUTION NMR | Cite: | Solution structure of the Grb2 N-terminal SH3 domain complexed with a ten-residue peptide derived from SOS: direct refinement against NOEs, J-couplings and 1H and 13C chemical shifts. J.Mol.Biol., 267, 1997
|
|
2H39
| Crystal Structure of an ADP-Glucose Phosphorylase from Arabidopsis thaliana with bound ADP-Glucose | Descriptor: | ADENOSINE-5'-DIPHOSPHATE-GLUCOSE, CHLORIDE ION, Probable galactose-1-phosphate uridyl transferase, ... | Authors: | McCoy, J.G, Wesenberg, G.E, Phillips Jr, G.N, Bitto, E, Bingman, C.A, Center for Eukaryotic Structural Genomics (CESG) | Deposit date: | 2006-05-22 | Release date: | 2006-06-13 | Last modified: | 2023-08-30 | Method: | X-RAY DIFFRACTION (2.23 Å) | Cite: | Crystal Structure of an ADP-Glucose Phosphorylase from Arabidopsis thaliana with bound ADP-Glucose To be Published
|
|
3HIP
| |
2KFZ
| KLENOW FRAGMENT WITH BRIDGING-SULFUR SUBSTRATE AND ZINC ONLY | Descriptor: | 5'-D(*GP*CP*TP*TP*AP*(US1)P*G)-3', KLENOW FRAGMENT OF DNA POLYMERASE I, MAGNESIUM ION, ... | Authors: | Brautigam, C.A, Sun, S, Piccirilli, J.A, Steitz, T.A. | Deposit date: | 1998-07-02 | Release date: | 1998-11-11 | Last modified: | 2024-02-21 | Method: | X-RAY DIFFRACTION (2.03 Å) | Cite: | Structures of normal single-stranded DNA and deoxyribo-3'-S-phosphorothiolates bound to the 3'-5' exonucleolytic active site of DNA polymerase I from Escherichia coli. Biochemistry, 38, 1999
|
|
2KFN
| KLENOW FRAGMENT WITH BRIDGING-SULFUR SUBSTRATE AND MANGANESE | Descriptor: | 5'-D(*GP*CP*TP*TP*AP*(US1)P*G)-3', KLENOW FRAGMENT OF DNA POLYMERASE I, MAGNESIUM ION, ... | Authors: | Brautigam, C.A, Sun, S, Piccirilli, J.A, Steitz, T.A. | Deposit date: | 1998-07-01 | Release date: | 1998-11-11 | Last modified: | 2024-02-21 | Method: | X-RAY DIFFRACTION (2.03 Å) | Cite: | Structures of normal single-stranded DNA and deoxyribo-3'-S-phosphorothiolates bound to the 3'-5' exonucleolytic active site of DNA polymerase I from Escherichia coli. Biochemistry, 38, 1999
|
|
2KMN
| |
2KZZ
| KLENOW FRAGMENT WITH NORMAL SUBSTRATE AND ZINC ONLY | Descriptor: | DNA (5'-D(*GP*CP*TP*T*AP*CP*G)-3'), PROTEIN (DNA POLYMERASE I), ZINC ION | Authors: | Brautigam, C.A, Sun, S, Piccirilli, J.A, Steitz, T.A. | Deposit date: | 1998-07-07 | Release date: | 1999-12-14 | Last modified: | 2024-02-21 | Method: | X-RAY DIFFRACTION (2.25 Å) | Cite: | Structures of normal single-stranded DNA and deoxyribo-3'-S-phosphorothiolates bound to the 3'-5' exonucleolytic active site of DNA polymerase I from Escherichia coli. Biochemistry, 38, 1999
|
|
2KZM
| KLENOW FRAGMENT WITH NORMAL SUBSTRATE AND ZINC AND MANGANESE | Descriptor: | DNA (5'-D(*GP*CP*TP*TP*A*CP*GP*C)-3'), MANGANESE (II) ION, PROTEIN (DNA POLYMERASE I), ... | Authors: | Brautigam, C.A, Sun, S, Piccirilli, J.A, Steitz, T.A. | Deposit date: | 1998-07-03 | Release date: | 1999-02-16 | Last modified: | 2024-02-21 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Structures of normal single-stranded DNA and deoxyribo-3'-S-phosphorothiolates bound to the 3'-5' exonucleolytic active site of DNA polymerase I from Escherichia coli. Biochemistry, 38, 1999
|
|