1IE2
 
 | | Solution Structure of an In Vitro Selected RNA which is Sequence Specifically Recognized by RBD12 of Hamster Nucleolin.sNRE (anti) | | Descriptor: | 5'-R(*GP*GP*CP*CP*GP*AP*AP*AP*UP*CP*CP*CP*GP*AP*AP*GP*UP*AP*GP*GP*CP*C)-3' | | Authors: | Bouvet, P, Allain, F.H.-T, Finger, L.D, Dieckmann, T, Feigon, J. | | Deposit date: | 2001-04-05 | | Release date: | 2001-06-20 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | Recognition of pre-formed and flexible elements of an RNA stem-loop by nucleolin.
J.Mol.Biol., 309, 2001
|
|
1K4X
 | | POTASSIUM FORM OF OXY-1.5 QUADRUPLEX DNA | | Descriptor: | DNA (5'-D(*GP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*G)-3') | | Authors: | Schultze, P, Hud, N.V, Smith, F.W, Feigon, J. | | Deposit date: | 1999-06-08 | | Release date: | 1999-06-23 | | Last modified: | 2023-12-27 | | Method: | SOLUTION NMR | | Cite: | The effect of sodium, potassium and ammonium ions on the conformation of the dimeric quadruplex formed by the Oxytricha nova telomere repeat oligonucleotide d(G(4)T(4)G(4)).
Nucleic Acids Res., 27, 1999
|
|
1RVH
 | | SOLUTION STRUCTURE OF THE DNA DODECAMER GCAAAATTTTGC | | Descriptor: | 5'-D(*GP*CP*AP*AP*AP*AP*TP*TP*TP*TP*GP*C)-3' | | Authors: | Stefl, R, Wu, H, Ravindranathan, S, Sklenar, V, Feigon, J. | | Deposit date: | 2003-12-13 | | Release date: | 2004-02-10 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | DNA A-tract bending in three dimensions: Solving the dA4T4 vs. dT4A4 conundrum.
Proc.Natl.Acad.Sci.USA, 101, 2004
|
|
1RVI
 | | SOLUTION STRUCTURE OF THE DNA DODECAMER CGTTTTAAAACG | | Descriptor: | 5'-D(*CP*GP*TP*TP*TP*TP*AP*AP*AP*AP*CP*G)-3' | | Authors: | Stefl, R, Wu, H, Ravindranathan, S, Sklenar, V, Feigon, J. | | Deposit date: | 2003-12-13 | | Release date: | 2004-02-10 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | DNA A-tract bending in three dimensions: Solving the dA4T4 vs. dT4A4 conundrum.
Proc.Natl.Acad.Sci.USA, 101, 2004
|
|
1Q75
 | |
2KYE
 | | Solution structure of the pseudouridine modified P6.1 hairpin of human telomerase RNA | | Descriptor: | RNA (5'-R(*GP*AP*GP*AP*GP*(PSU)P*(PSU)P*GP*GP*GP*CP*(PSU)P*CP*(PSU)P*C)-3') | | Authors: | Kim, N.-K, Theimer, C.A, Mitchell, J.R, Collins, K, Feigon, J. | | Deposit date: | 2010-05-25 | | Release date: | 2010-06-30 | | Last modified: | 2024-05-01 | | Method: | SOLUTION NMR | | Cite: | Effect of pseudouridylation on the structure and activity of the catalytically essential P6.1 hairpin in human telomerase RNA.
Nucleic Acids Res., 38, 2010
|
|
2L3E
 | | Solution structure of P2a-J2a/b-P2b of human telomerase RNA | | Descriptor: | 35-MER | | Authors: | Zhang, Q, Kim, N, Peterson, R.D, Wang, Z, Feigon, J. | | Deposit date: | 2010-09-13 | | Release date: | 2010-11-17 | | Last modified: | 2024-05-01 | | Method: | SOLUTION NMR | | Cite: | Inaugural Article: Structurally conserved five nucleotide bulge determines the overall topology of the core domain of human telomerase RNA.
Proc.Natl.Acad.Sci.USA, 107, 2010
|
|
1TP4
 | |
1P9C
 | |
1K4A
 | | STRUCTURE OF AGAA RNA TETRALOOP, NMR, 20 STRUCTURES | | Descriptor: | 5'-R(*GP*GP*UP*UP*CP*AP*GP*AP*AP*GP*AP*AP*CP*C)-3' | | Authors: | Wu, H, Yang, P.K, Butcher, S.E, Kang, S, Chanfreau, G, Feigon, J. | | Deposit date: | 2001-10-07 | | Release date: | 2001-12-19 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | A novel family of RNA tetraloop structure forms the recognition site for Saccharomyces cerevisiae RNase III.
EMBO J., 20, 2001
|
|
1P9D
 | |
1RAW
 | |
1K4B
 | | STRUCTURE OF AGUU RNA TETRALOOP, NMR, 20 STRUCTURES | | Descriptor: | 5'-R(*GP*GP*UP*UP*CP*AP*GP*UP*UP*GP*AP*AP*CP*C)-3' | | Authors: | Wu, H, Yang, P.K, Butcher, S.E, Kang, S, Chanfreau, G, Feigon, J. | | Deposit date: | 2001-10-07 | | Release date: | 2001-12-19 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | A novel family of RNA tetraloop structure forms the recognition site for Saccharomyces cerevisiae RNase III.
EMBO J., 20, 2001
|
|
1R3X
 | | INTRAMOLECULAR DNA TRIPLEX WITH RNA THIRD STRAND, NMR, 10 STRUCTURES | | Descriptor: | DNA (5'-D(*AP*GP*AP*GP*AP*GP*AP*A)-3'), DNA (5'-D(*TP*TP*CP*TP*CP*TP*CP*T)-3'), RNA (5'-R(*UP*CP*UP*CP*UP*CP*UP*U)-3') | | Authors: | Gotfredsen, C.H, Schultze, P, Feigon, J. | | Deposit date: | 1998-02-06 | | Release date: | 1998-05-20 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | Solution Structure of an Intramolecular Pyrimidine-Purine-Pyrimidine Triplex Containing an RNA Third Strand
J.Am.Chem.Soc., 120, 1998
|
|
1T4L
 | | Solution structure of double-stranded RNA binding domain of S. cerevisiae RNase III (Rnt1p) in complex with the 5' terminal RNA hairpin of snR47 precursor | | Descriptor: | 5' terminal hairpin of snR47 precursor, Ribonuclease III | | Authors: | Wu, H, Henras, A, Chanfreau, G, Feigon, J. | | Deposit date: | 2004-04-29 | | Release date: | 2004-06-01 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | Structural basis for recognition of the AGNN tetraloop RNA fold by the double-stranded RNA-binding domain of Rnt1p RNase III.
Proc.Natl.Acad.Sci.USA, 101, 2004
|
|
148D
 | |
185D
 | |
1DV0
 | |
2LUP
 | |
2LUQ
 | |
1CG7
 | | HMG PROTEIN NHP6A FROM SACCHAROMYCES CEREVISIAE | | Descriptor: | PROTEIN (NON HISTONE PROTEIN 6 A) | | Authors: | Allain, F.H.T, Yen, Y.M, Masse, J.E, Schultze, P, Dieckmann, T, Johnson, R.C, Feigon, J. | | Deposit date: | 1999-03-27 | | Release date: | 1999-10-14 | | Last modified: | 2023-12-27 | | Method: | SOLUTION NMR | | Cite: | Solution structure of the HMG protein NHP6A and its interaction with DNA reveals the structural determinants for non-sequence-specific binding.
EMBO J., 18, 1999
|
|
1QWB
 | |
1QWA
 | | NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12. | | Descriptor: | 18S ribosomal RNA, 5'ETS | | Authors: | Finger, L.D, Trantirek, L, Johansson, C, Feigon, J. | | Deposit date: | 2003-09-01 | | Release date: | 2003-11-25 | | Last modified: | 2024-05-01 | | Method: | SOLUTION NMR | | Cite: | Solution Strucutres of Stem-loop RNAs that Bind to the Two N-terminal RNA Binding Domains of Nucleolin
Nucleic Acids Res., 31, 2003
|
|
1J5N
 | | Solution Structure of the Non-Sequence-Specific HMGB protein NHP6A in complex with SRY DNA | | Descriptor: | 5'-D(*CP*TP*GP*AP*AP*CP*AP*AP*TP*CP*AP*CP*CP*CP*C)-3', 5'-D(*GP*GP*GP*GP*TP*GP*AP*TP*TP*GP*TP*TP*CP*AP*G)-3', Nonhistone chromosomal protein 6A | | Authors: | Masse, J.E, Wong, B, Yen, Y.-M, Allain, F.H.-T, Johnson, R.C, Feigon, J. | | Deposit date: | 2002-05-15 | | Release date: | 2002-10-16 | | Last modified: | 2023-12-27 | | Method: | SOLUTION NMR | | Cite: | The S. cerevisiae architectural HMGB protein NHP6A complexed with DNA: DNA and protein conformational changes upon binding
J.Mol.Biol., 323, 2002
|
|
1LWM
 | | Solution Structure of the Sequence-Non-Specific HMGB protein NHP6A | | Descriptor: | NONHISTONE CHROMOSOMAL PROTEIN 6A | | Authors: | Masse, J.E, Wong, B, Yen, Y.-M, Allain, F.H.-T, Johnson, R.C, Feigon, J. | | Deposit date: | 2002-05-31 | | Release date: | 2002-10-16 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | The S. cerevisiae architectural HMGB protein NHP6A complexed with DNA: DNA and protein conformational changes upon binding
J.Mol.Biol., 323, 2002
|
|
