7OTB
Ruthenium polypridyl complex bound to a unimolecular chair-form G-quadruplex
Summary for 7OTB
Entry DOI | 10.2210/pdb7otb/pdb |
Descriptor | DNA (5'-D(*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*TP*GP*GP*G)-3'), POTASSIUM ION, BARIUM ION, ... (5 entities in total) |
Functional Keywords | ruthenium, g-quadruplex, chair, telomeric, dna |
Biological source | synthetic construct |
Total number of polymer chains | 1 |
Total formula weight | 7828.88 |
Authors | McQuaid, K.T.,Cardin, C.J.,Hall, J.P.,Paterson, N.G.,Baumgaertner, L. (deposition date: 2021-06-09, release date: 2022-04-06, Last modification date: 2024-06-19) |
Primary citation | McQuaid, K.T.,Takahashi, S.,Baumgaertner, L.,Cardin, D.J.,Paterson, N.G.,Hall, J.P.,Sugimoto, N.,Cardin, C.J. Ruthenium Polypyridyl Complex Bound to a Unimolecular Chair-Form G-Quadruplex. J.Am.Chem.Soc., 144:5956-5964, 2022 Cited by PubMed Abstract: The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Λ-[Ru(phen)(qdppz)] displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (T), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T-T-A. The two remaining wide lateral loops are linked through a third K ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work. PubMed: 35324198DOI: 10.1021/jacs.2c00178 PDB entries with the same primary citation |
Experimental method | X-RAY DIFFRACTION (1.6 Å) |
Structure validation
Download full validation report
