5BS8
Crystal structure of a topoisomerase II complex
Summary for 5BS8
Entry DOI | 10.2210/pdb5bs8/pdb |
Related | 5BTA 5BTC 5BTD 5BTF 5BTG 5BTI 5BTL 5BTN |
Descriptor | DNA gyrase subunit A, DNA gyrase subunit B, DNA substrate 24-mer GGTCATGAATGACTATGCACGTAA, ... (7 entities in total) |
Functional Keywords | protein-dna complex, topoisomerase ii, isomerase-dna complex, isomerase/dna |
Biological source | Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv) More |
Cellular location | Cytoplasm : P9WG47 P9WG45 |
Total number of polymer chains | 8 |
Total formula weight | 199338.86 |
Authors | Blower, T.R.,Williamson, B.H.,Kerns, R.J.,Berger, J.M. (deposition date: 2015-06-01, release date: 2016-03-02, Last modification date: 2023-11-15) |
Primary citation | Blower, T.R.,Williamson, B.H.,Kerns, R.J.,Berger, J.M. Crystal structure and stability of gyrase-fluoroquinolone cleaved complexes from Mycobacterium tuberculosis. Proc.Natl.Acad.Sci.USA, 113:1706-1713, 2016 Cited by PubMed: 26792525DOI: 10.1073/pnas.1525047113 PDB entries with the same primary citation |
Experimental method | X-RAY DIFFRACTION (2.399 Å) |
Structure validation
Download full validation report