5E3O

Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT)

Experimental procedure

Experimental method	SINGLE WAVELENGTH
Source type	SYNCHROTRON
Source details	APS BEAMLINE 24-ID-C
Synchrotron site	APS
Beamline	24-ID-C
Temperature [K]	100
Detector technology	CCD
Collection date	2011-03-05
Detector	ADSC QUANTUM 315
Wavelength(s)	0.97949
Spacegroup name	P 21 21 21
Unit cell lengths	43.190, 94.320, 154.340
Unit cell angles	90.00, 90.00, 90.00

Refinement procedure

Resolution	59.727 - 2.780
R-factor	0.2222
Rwork	0.220
R-free	0.26670
Structure solution method	MOLECULAR REPLACEMENT
RMSD bond length	0.005
RMSD bond angle	0.804
Data scaling software	Aimless (0.5.14)
Phasing software	PHASER (2.5.7)
Refinement software	PHENIX ((phenix.refine: 1.9_1692))

Data quality characteristics

	Overall	Inner shell	Outer shell
Low resolution limit [Å]	80.480	80.480	2.930
High resolution limit [Å]	2.780	8.780	2.780
Rmerge	0.071	0.036	0.719
Rpim	0.035	0.018	0.349
Total number of observations	80167	2508	12616
Number of reflections	15712
<I/σ(I)>	13.8	28	2.6
Completeness [%]	94.3	97	99.9
Redundancy	5.1	4.3	5.3
CC(1/2)	0.998	0.999	0.862

Crystallization Conditions

crystal ID	method	pH	temperature	details
1	VAPOR DIFFUSION, HANGING DROP	8.5	277	0.2 M Sodium citrate, 0.1 M TRIS-HCl pH 8.5, 36% PEG 400