[English] 日本語
Yorodumi
- PDB-6w3n: APE1 exonuclease substrate complex D148E -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 6w3n
TitleAPE1 exonuclease substrate complex D148E
Components
  • DNA (5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*(C7R))-3')
  • DNA-(apurinic or apyrimidinic site) lyase
  • GGATCCGTCGATCGCATCAGC
  • TCGACGGATCC
KeywordsDNA BINDING PROTEIN/DNA / nuclease / abasic site / DNA repair / DNA BINDING PROTEIN / DNA BINDING PROTEIN-DNA complex
Function / homology
Function and homology information


Resolution of Abasic Sites (AP sites) / phosphodiesterase activity, acting on 3'-phosphoglycolate-terminated DNA strands / telomere maintenance via base-excision repair / class II DNA-(apurinic or apyrimidinic site) endonuclease activity / deoxyribonuclease (pyrimidine dimer) activity / DNA-(abasic site) binding / double-stranded DNA exodeoxyribonuclease activity / exodeoxyribonuclease III / double-stranded DNA 3'-5' DNA exonuclease activity / Displacement of DNA glycosylase by APEX1 ...Resolution of Abasic Sites (AP sites) / phosphodiesterase activity, acting on 3'-phosphoglycolate-terminated DNA strands / telomere maintenance via base-excision repair / class II DNA-(apurinic or apyrimidinic site) endonuclease activity / deoxyribonuclease (pyrimidine dimer) activity / DNA-(abasic site) binding / double-stranded DNA exodeoxyribonuclease activity / exodeoxyribonuclease III / double-stranded DNA 3'-5' DNA exonuclease activity / Displacement of DNA glycosylase by APEX1 / positive regulation of gene expression via chromosomal CpG island demethylation / double-stranded telomeric DNA binding / 3'-5'-DNA exonuclease activity / uracil DNA N-glycosylase activity / phosphoric diester hydrolase activity / Hydrolases; Acting on ester bonds; Endodeoxyribonucleases producing 5'-phosphomonoesters / DNA catabolic process / phosphodiesterase I activity / Resolution of AP sites via the multiple-nucleotide patch replacement pathway / Abasic sugar-phosphate removal via the single-nucleotide replacement pathway / POLB-Dependent Long Patch Base Excision Repair / PCNA-Dependent Long Patch Base Excision Repair / base-excision repair, gap-filling / 3'-5' exonuclease activity / regulation of mRNA stability / DNA-(apurinic or apyrimidinic site) endonuclease activity / cell redox homeostasis / telomere maintenance / DNA endonuclease activity / chromatin DNA binding / base-excision repair / RNA-DNA hybrid ribonuclease activity / transcription corepressor activity / endonuclease activity / DNA recombination / regulation of apoptotic process / damaged DNA binding / transcription coactivator activity / chromosome, telomeric region / oxidoreductase activity / nuclear speck / ribosome / DNA repair / centrosome / nucleolus / perinuclear region of cytoplasm / endoplasmic reticulum / positive regulation of transcription by RNA polymerase II / mitochondrion / DNA binding / RNA binding / nucleoplasm / metal ion binding / nucleus / cytoplasm
Similarity search - Function
AP endonucleases family 1 signature 2. / AP endonuclease 1, conserved site / AP endonucleases family 1 signature 3. / AP endonuclease 1, binding site / AP endonucleases family 1 signature 1. / AP endonuclease 1 / AP endonucleases family 1 profile. / Deoxyribonuclease I; Chain A / Endonuclease/exonuclease/phosphatase / Endonuclease/exonuclease/phosphatase ...AP endonucleases family 1 signature 2. / AP endonuclease 1, conserved site / AP endonucleases family 1 signature 3. / AP endonuclease 1, binding site / AP endonucleases family 1 signature 1. / AP endonuclease 1 / AP endonucleases family 1 profile. / Deoxyribonuclease I; Chain A / Endonuclease/exonuclease/phosphatase / Endonuclease/exonuclease/phosphatase / Endonuclease/Exonuclease/phosphatase family / Endonuclease/exonuclease/phosphatase superfamily / 4-Layer Sandwich / Alpha Beta
Similarity search - Domain/homology
DNA / DNA (> 10) / DNA repair nuclease/redox regulator APEX1
Similarity search - Component
Biological speciesHomo sapiens (human)
synthetic construct (others)
MethodX-RAY DIFFRACTION / MOLECULAR REPLACEMENT / Resolution: 2.69 Å
AuthorsFreudenthal, B.D. / Whitaker, A.M.
Funding support United States, 2items
OrganizationGrant numberCountry
National Institutes of Health/National Institute of Environmental Health Sciences (NIH/NIEHS)R01-ES029203 United States
American Cancer SocietyPF-1815401-DMC United States
CitationJournal: DNA Repair (Amst.) / Year: 2020
Title: Molecular and structural characterization of disease-associated APE1 polymorphisms.
Authors: Whitaker, A.M. / Stark, W.J. / Flynn, T.S. / Freudenthal, B.D.
History
DepositionMar 9, 2020Deposition site: RCSB / Processing site: RCSB
Revision 1.0Jun 10, 2020Provider: repository / Type: Initial release
Revision 1.1Oct 18, 2023Group: Data collection / Database references / Refinement description
Category: chem_comp_atom / chem_comp_bond ...chem_comp_atom / chem_comp_bond / database_2 / pdbx_initial_refinement_model
Item: _database_2.pdbx_DOI / _database_2.pdbx_database_accession

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
C: TCGACGGATCC
D: DNA (5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*(C7R))-3')
E: GGATCCGTCGATCGCATCAGC
A: DNA-(apurinic or apyrimidinic site) lyase
B: DNA-(apurinic or apyrimidinic site) lyase
hetero molecules


Theoretical massNumber of molelcules
Total (without water)75,3437
Polymers75,2415
Non-polymers1022
Water75742
1
C: TCGACGGATCC
D: DNA (5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*(C7R))-3')
E: GGATCCGTCGATCGCATCAGC
B: DNA-(apurinic or apyrimidinic site) lyase
hetero molecules


Theoretical massNumber of molelcules
Total (without water)44,0785
Polymers44,0384
Non-polymers401
Water543
TypeNameSymmetry operationNumber
identity operation1_555x,y,z1
Buried area4100 Å2
ΔGint-31 kcal/mol
Surface area17950 Å2
MethodPISA
2
A: DNA-(apurinic or apyrimidinic site) lyase
hetero molecules


Theoretical massNumber of molelcules
Total (without water)31,2652
Polymers31,2031
Non-polymers621
Water181
TypeNameSymmetry operationNumber
identity operation1_555x,y,z1
Buried area170 Å2
ΔGint2 kcal/mol
Surface area12300 Å2
MethodPISA
Unit cell
Length a, b, c (Å)71.554, 65.074, 91.424
Angle α, β, γ (deg.)90.000, 109.928, 90.000
Int Tables number4
Space group name H-MP1211
Space group name HallP2yb
Symmetry operation#1: x,y,z
#2: -x,y+1/2,-z

-
Components

-
DNA chain , 3 types, 3 molecules CDE

#1: DNA chain TCGACGGATCC


Mass: 3334.186 Da / Num. of mol.: 1 / Source method: obtained synthetically / Source: (synth.) synthetic construct (others)
#2: DNA chain DNA (5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*(C7R))-3')


Mass: 3077.070 Da / Num. of mol.: 1 / Source method: obtained synthetically / Source: (synth.) synthetic construct (others)
#3: DNA chain GGATCCGTCGATCGCATCAGC


Mass: 6424.148 Da / Num. of mol.: 1 / Source method: obtained synthetically / Source: (synth.) synthetic construct (others)

-
Protein , 1 types, 2 molecules AB

#4: Protein DNA-(apurinic or apyrimidinic site) lyase / APEX nuclease / APEN / Apurinic-apyrimidinic endonuclease 1 / APE-1 / REF-1 / Redox factor-1


Mass: 31202.566 Da / Num. of mol.: 2 / Mutation: D148E
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: APEX1, APE, APE1, APEX, APX, HAP1, REF1 / Production host: Escherichia coli (E. coli)
References: UniProt: P27695, Hydrolases; Acting on ester bonds, DNA-(apurinic or apyrimidinic site) lyase

-
Non-polymers , 3 types, 44 molecules

#5: Chemical ChemComp-CA / CALCIUM ION


Mass: 40.078 Da / Num. of mol.: 1 / Source method: obtained synthetically / Formula: Ca
#6: Chemical ChemComp-EDO / 1,2-ETHANEDIOL / ETHYLENE GLYCOL


Mass: 62.068 Da / Num. of mol.: 1 / Source method: obtained synthetically / Formula: C2H6O2
#7: Water ChemComp-HOH / water


Mass: 18.015 Da / Num. of mol.: 42 / Source method: isolated from a natural source / Formula: H2O

-
Details

Has ligand of interestN

-
Experimental details

-
Experiment

ExperimentMethod: X-RAY DIFFRACTION / Number of used crystals: 1

-
Sample preparation

CrystalDensity Matthews: 2.66 Å3/Da / Density % sol: 53.75 %
Crystal growTemperature: 291 K / Method: vapor diffusion, sitting drop
Details: 7% PEG20000, 100 mM sodium citrate, 15% glycerol, 5 mM calcium chloride

-
Data collection

DiffractionMean temperature: 100 K / Serial crystal experiment: N
Diffraction sourceSource: ROTATING ANODE / Type: RIGAKU MICROMAX-007 / Wavelength: 1.54 Å
DetectorType: DECTRIS PILATUS 200K / Detector: PIXEL / Date: Jun 7, 2018
RadiationProtocol: SINGLE WAVELENGTH / Monochromatic (M) / Laue (L): M / Scattering type: x-ray
Radiation wavelengthWavelength: 1.54 Å / Relative weight: 1
ReflectionResolution: 2.69→25 Å / Num. obs: 37101 / % possible obs: 96.2 % / Redundancy: 2.9 % / Biso Wilson estimate: 57.27 Å2 / Rrim(I) all: 0.21 / Net I/σ(I): 7.8
Reflection shellResolution: 2.7→2.75 Å / Num. unique obs: 1645 / CC1/2: 0.714 / Rrim(I) all: 1

-
Processing

Software
NameVersionClassification
PHENIX1.17.1_3660refinement
HKL-3000data reduction
HKL-3000data scaling
PHENIX1.17.1_3660phasing
RefinementMethod to determine structure: MOLECULAR REPLACEMENT
Starting model: 5W4N
Resolution: 2.69→24.76 Å / SU ML: 0.5056 / Cross valid method: FREE R-VALUE / σ(F): 1.33 / Phase error: 37.7295
Stereochemistry target values: GeoStd + Monomer Library + CDL v1.2
RfactorNum. reflection% reflection
Rfree0.3084 3467 9.55 %
Rwork0.2491 32845 -
obs0.2549 36312 84.6 %
Solvent computationShrinkage radii: 0.9 Å / VDW probe radii: 1.11 Å / Solvent model: FLAT BULK SOLVENT MODEL
Displacement parametersBiso mean: 57.64 Å2
Refinement stepCycle: LAST / Resolution: 2.69→24.76 Å
ProteinNucleic acidLigandSolventTotal
Num. atoms4369 835 5 42 5251
Refine LS restraints
Refine-IDTypeDev idealNumber
X-RAY DIFFRACTIONf_bond_d0.01225422
X-RAY DIFFRACTIONf_angle_d1.35887527
X-RAY DIFFRACTIONf_chiral_restr0.2671808
X-RAY DIFFRACTIONf_plane_restr0.008830
X-RAY DIFFRACTIONf_dihedral_angle_d26.82842066
LS refinement shell
Resolution (Å)Rfactor RfreeNum. reflection RfreeRfactor RworkNum. reflection RworkRefine-ID% reflection obs (%)
2.69-2.730.44641000.3752868X-RAY DIFFRACTION56.34
2.73-2.770.42531280.38151130X-RAY DIFFRACTION72.8
2.77-2.810.42941240.36461249X-RAY DIFFRACTION79.73
2.81-2.850.46131290.34161222X-RAY DIFFRACTION79.1
2.85-2.90.42281230.33741200X-RAY DIFFRACTION78.33
2.9-2.950.35481360.33081284X-RAY DIFFRACTION80.27
2.95-30.41461250.36051176X-RAY DIFFRACTION79.18
3-3.060.46371290.40781336X-RAY DIFFRACTION83.43
3.06-3.120.47311460.38311335X-RAY DIFFRACTION86.1
3.12-3.190.41681500.32071313X-RAY DIFFRACTION86.01
3.19-3.260.43241280.28681406X-RAY DIFFRACTION88.31
3.26-3.350.36881500.28431339X-RAY DIFFRACTION87.03
3.35-3.440.35981350.27371392X-RAY DIFFRACTION88.99
3.44-3.540.31781350.2631409X-RAY DIFFRACTION88.74
3.54-3.650.31011400.26191386X-RAY DIFFRACTION89.55
3.65-3.780.2971610.2471347X-RAY DIFFRACTION88.29
3.78-3.930.30621450.24421324X-RAY DIFFRACTION86.62
3.93-4.110.30131360.23591376X-RAY DIFFRACTION87.45
4.11-4.330.3021590.23111349X-RAY DIFFRACTION86.72
4.33-4.60.2751540.20231368X-RAY DIFFRACTION88.9
4.6-4.950.2581360.2061390X-RAY DIFFRACTION89.34
4.95-5.440.29671530.21481420X-RAY DIFFRACTION91.35
5.44-6.220.19491560.20611402X-RAY DIFFRACTION91.32
6.22-7.790.25911510.22391409X-RAY DIFFRACTION90.86
7.79-24.760.21361380.17041415X-RAY DIFFRACTION90.19

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more