[English] 日本語
Yorodumi
- PDB-6gml: Structure of paused transcription complex Pol II-DSIF-NELF -

+
Open data


ID or keywords:

Loading...

no data

-
Basic information

Entry
Database: PDB / ID: 6gml
TitleStructure of paused transcription complex Pol II-DSIF-NELF
Components
  • (DNA-directed RNA polymerase ...Polymerase) x 3
  • (Negative elongation factor ...) x 4
  • (RNA polymerase II subunit ...) x 5
  • (Transcription elongation factor ...) x 2
  • (Uncharacterized ...) x 3
  • DNA-directed RNA polymerases I, II, and III subunit RPABC3RNA polymerase
  • Non-template DNA
  • TAR RNA
  • Template DNA
KeywordsTRANSCRIPTION / RNA polymerase II / pausing / NELF / DSIF
Function / homologyPol II subunit B9, C-terminal zinc ribbon / Hepatitis delta antigen (HDAg) domain / RPB5-like RNA polymerase subunit superfamily / RNA-binding domain superfamily / RPB6/omega subunit-like superfamily / RNA polymerase, RBP11-like subunit / DNA-directed RNA polymerase, insert domain superfamily / RNA polymerase Rpb5, N-terminal domain superfamily / NusG, N-terminal domain superfamily / RNA polymerase Rpb7-like, N-terminal domain superfamily ...Pol II subunit B9, C-terminal zinc ribbon / Hepatitis delta antigen (HDAg) domain / RPB5-like RNA polymerase subunit superfamily / RNA-binding domain superfamily / RPB6/omega subunit-like superfamily / RNA polymerase, RBP11-like subunit / DNA-directed RNA polymerase, insert domain superfamily / RNA polymerase Rpb5, N-terminal domain superfamily / NusG, N-terminal domain superfamily / RNA polymerase Rpb7-like, N-terminal domain superfamily / DNA-directed RNA polymerase, subunit 2, hybrid-binding domain superfamily / RNA polymerase Rpb2, domain 2 superfamily / RNA polymerase RBP11 / HIV elongation arrest and recovery / RNA polymerase Rpb1, funnel domain superfamily / Rpb4/RPC9 superfamily / Spt4 superfamily / RNA polymerase Rpb1, domain 7 superfamily / NGN domain, eukaryotic / DNA-directed RNA polymerase subunit Rpb5-like / Transcription elongation factor SPT5 / DNA-directed RNA polymerases I, II, and III subunit RPABC4 / RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) / KOW motif / Negative elongation factor E, RNA recognition motif / Negative elongation factor E / S1 RNA binding domain / Transcription elongation factor Spt5, eukaryote / DNA-directed RNA polymerase, insert domain / DNA-directed RNA polymerase, RpoA/D/Rpb3-type / DNA-directed RNA polymerase subunit/transcription factor S / RNA polymerase subunit, RPB6/omega / Nucleic acid-binding, OB-fold / Nucleotide-binding alpha-beta plait domain superfamily / DNA-directed RNA polymerase RPB5 subunit, eukaryote/virus / Ribosomal protein L2, domain 2 / RNA polymerase Rpb2, OB-fold / DNA-directed RNA polymerase, subunit 2 / DNA-directed RNA polymerase M, 15kDa subunit, conserved site / RNA polymerase subunit RPABC4/transcription elongation factor Spt4 / RNA polymerase, subunit H/Rpb5, conserved site / Archaeal RpoH /eukaryotic RPB5 RNA polymerase subunit / DNA-directed RNA polymerase, 14-18kDa subunit, conserved site / RNA polymerases, subunit N, zinc binding site / Spt5 transcription elongation factor, N-terminal / Spt4/RpoE2 zinc finger / RNA-binding domain, S1 / RNA polymerase subunit RPB10 / Spt5 C-terminal domain / Negative elongation factor A / DNA-directed RNA polymerase, subunit RPB6 / RNA polymerase Rpb2, domain 6 / RNA polymerase Rpb1, domain 2 / Cofactor of BRCA1 / RNA polymerases L / 13 to 16 Kd subunits signature. / Cofactor of BRCA1 (COBRA1) / Spt5 transcription elongation factor, acidic N-terminal / RNA polymerase Rpb3/Rpb11 dimerisation domain / Eukaryotic RNA polymerase II heptapeptide repeat. / RNA polymerases D / 30 to 40 Kd subunits signature. / Zinc finger TFIIS-type signature. / RNA polymerases M / 15 Kd subunits signature. / RNA polymerases H / 23 Kd subunits signature. / RNA polymerases K / 14 to 18 Kd subunits signature. / RNA polymerases N / 8 Kd subunits signature. / RNA polymerases beta chain signature. / RNA polymerase Rpb1 C-terminal repeat / Eukaryotic RNA Recognition Motif (RRM) profile. / Zinc finger TFIIS-type profile. / Hepatitis delta antigen (HDAg) domain profile. / Formation of RNA Pol II elongation complex / Formation of the Early Elongation Complex / Formation of HIV elongation complex in the absence of HIV Tat / Formation of the HIV-1 Early Elongation Complex / RNA Pol II CTD phosphorylation and interaction with CE during HIV infection / Formation of HIV-1 elongation complex containing HIV-1 Tat / Pausing and recovery of Tat-mediated HIV elongation / Abortive elongation of HIV-1 transcript in the absence of Tat / Spt4/RpoE2 zinc finger / RNA polymerase Rpb1, domain 4 / RNA polymerase Rpb3/RpoA insert domain / RNA polymerase Rpb4 / Transcription factor S-II (TFIIS) / RNA polymerase Rpb5, C-terminal domain / RNA polymerase Rpb6 / RNA polymerase Rpb3/Rpb11 dimerisation domain / RNA polymerases N / 8 kDa subunit / RNA polymerases M/15 Kd subunit / Early transcription elongation factor of RNA pol II, NGN section / DNA directed RNA polymerase, 7 kDa subunit / RNA polymerase Rpb8 / RNA polymerase Rpb5, N-terminal domain / SHS2 domain found in N terminus of Rpb7p/Rpc25p/MJ0397 / RNA polymerase Rpb1, domain 5 / RNA polymerase Rpb2, domain 7 / RNA polymerase Rpb2, domain 2 / RNA polymerase beta subunit / RNA polymerase Rpb2, domain 3 / RNA polymerase Rpb2, domain 4 / RNA polymerase Rpb2, domain 5
Function and homology information
Specimen sourceHomo sapiens (human)
Sus scrofa (pig)
Human immunodeficiency virus 1
MethodELECTRON MICROSCOPY / single particle reconstruction / cryo EM / 3.2 Å resolution
AuthorsVos, S.M. / Farnung, L. / Urlaub, H. / Cramer, P.
CitationJournal: Nature / Year: 2018
Title: Structure of paused transcription complex Pol II-DSIF-NELF.
Authors: Seychelle M Vos / Lucas Farnung / Henning Urlaub / Patrick Cramer
Validation Report
SummaryFull reportAbout validation report
DateDeposition: May 27, 2018 / Release: Sep 5, 2018
RevisionDateData content typeGroupCategoryItemProviderType
1.0Sep 5, 2018Structure modelrepositoryInitial release
1.1Sep 12, 2018Structure modelData collection / Database referencescitation_citation.journal_volume / _citation.page_first / _citation.page_last
1.2Oct 3, 2018Structure modelData collection / Experimental preparationem_sample_support_em_sample_support.grid_type

-
Structure visualization

Movie
  • Deposited structure unit
  • Imaged by Jmol
  • Download
  • Superimposition on EM map
  • EMDB-0038
  • Imaged by UCSF Chimera
  • Download
Movie viewer
Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
A: DNA-directed RNA polymerase subunit
B: DNA-directed RNA polymerase subunit beta
C: RNA polymerase II subunit C
E: RNA polymerase II subunit E
F: RNA polymerase II subunit F
H: DNA-directed RNA polymerases I, II, and III subunit RPABC3
I: DNA-directed RNA polymerase II subunit RPB9
J: Uncharacterized protein
K: Uncharacterized protein
L: Uncharacterized protein
N: Non-template DNA
P: TAR RNA
T: Template DNA
U: Negative elongation factor A
V: Negative elongation factor B
W: Negative elongation factor C/D
X: Negative elongation factor E
Y: Transcription elongation factor SPT4
Z: Transcription elongation factor SPT5
D: RNA polymerase II subunit D
G: RNA polymerase II subunit G
hetero molecules


Theoretical massNumber of molelcules
Total (without water)928,71231
Polyers928,09921
Non-polymers61310
Water0
1


TypeNameSymmetry operationNumber
identity operation1_5551

-
Components

+
DNA-directed RNA polymerase ... , 3 types, 3 molecules ABI

#1: Protein/peptide DNA-directed RNA polymerase subunit / Polymerase


Mass: 217551.156 Da / Num. of mol.: 1 / Source: (natural) Sus scrofa (pig) / Organ: Thymus
References: UniProt: I3LJR4*PLUS, DNA-directed RNA polymerase
#2: Protein/peptide DNA-directed RNA polymerase subunit beta / Polymerase


Mass: 134041.422 Da / Num. of mol.: 1 / Source: (natural) Sus scrofa (pig) / Organ: Thymus / References: UniProt: I3LGP4, DNA-directed RNA polymerase
#7: Protein/peptide DNA-directed RNA polymerase II subunit RPB9 / Polymerase / RNA polymerase II subunit B9 / DNA-directed RNA polymerase II subunit I / RNA polymerase II 14.5 kDa subunit / RPB14.5


Mass: 14541.221 Da / Num. of mol.: 1 / Source: (natural) Sus scrofa (pig) / Organ: Thymus / References: UniProt: P60899

+
RNA polymerase II subunit ... , 5 types, 5 molecules CEFDG

#3: Protein/peptide RNA polymerase II subunit C /


Mass: 30997.557 Da / Num. of mol.: 1 / Source: (natural) Sus scrofa (pig) / Organ: Thymus / References: UniProt: I3LCH3
#4: Protein/peptide RNA polymerase II subunit E /


Mass: 24644.318 Da / Num. of mol.: 1 / Source: (natural) Sus scrofa (pig) / Organ: Thymus / References: UniProt: I3LSI7
#5: Protein/peptide RNA polymerase II subunit F /


Mass: 14477.001 Da / Num. of mol.: 1 / Source: (natural) Sus scrofa (pig) / References: UniProt: F1SKN8
#20: Protein/peptide RNA polymerase II subunit D /


Mass: 16331.255 Da / Num. of mol.: 1 / Source: (natural) Sus scrofa (pig) / Organ: Thymus / References: UniProt: A0A287ADR4
#21: Protein/peptide RNA polymerase II subunit G /


Mass: 19314.283 Da / Num. of mol.: 1 / Source: (natural) Sus scrofa (pig) / Organ: Thymus / References: UniProt: I3LJZ9

+
Uncharacterized ... , 3 types, 3 molecules JKL

#8: Protein/peptide Uncharacterized protein


Mass: 7702.517 Da / Num. of mol.: 1 / Source: (natural) Sus scrofa (pig) / Organ: Thymus / References: UniProt: A0A287B432*PLUS
#9: Protein/peptide Uncharacterized protein


Mass: 13310.284 Da / Num. of mol.: 1 / Source: (natural) Sus scrofa (pig) / Organ: Thymus / References: UniProt: F1RKE4
#10: Protein/peptide Uncharacterized protein


Mass: 7018.244 Da / Num. of mol.: 1 / Source: (natural) Sus scrofa (pig) / Organ: Thymus / References: UniProt: I3LN51

+
DNA chain , 2 types, 2 molecules NT

#11: DNA chain Non-template DNA / hSPT5 / DRB sensitivity-inducing factor 160 kDa subunit / DSIF p160 / DRB sensitivity-inducing factor large subunit / DSIF large subunit / Tat-cotransactivator 1 protein / Tat-CT1 protein


Mass: 14712.466 Da / Num. of mol.: 1
Mutation: bases 1-23 mutated, original sequence: CTCTGGCTATCTAGGGAACCCTC
Source: (synth.) Human immunodeficiency virus 1
Details: mutated from original sequence for structural work Mutation
#13: DNA chain Template DNA


Mass: 14910.556 Da / Num. of mol.: 1
Mutation: Bases 35-48 were mutated from ATAGATAGCCAGAG to AGGTACTAGTGTAC
Source: (synth.) Human immunodeficiency virus 1

+
Negative elongation factor ... , 4 types, 4 molecules UVWX

#14: Protein/peptide Negative elongation factor A / NELF-A / Wolf-Hirschhorn syndrome candidate 2 protein


Mass: 57343.598 Da / Num. of mol.: 1 / Source: (gene. exp.) Homo sapiens (human) / Gene: NELFA, WHSC2, P/OKcl.15 / Production host: Trichoplusia ni (cabbage looper) / References: UniProt: Q9H3P2
#15: Protein/peptide Negative elongation factor B / NELF-B / Cofactor of BRCA1


Mass: 64577.230 Da / Num. of mol.: 1 / Source: (gene. exp.) Homo sapiens (human) / Gene: NELFB, COBRA1, KIAA1182 / Production host: Trichoplusia ni (cabbage looper) / References: UniProt: Q8WX92
#16: Protein/peptide Negative elongation factor C/D / NELF-C/D / TH1-like protein


Mass: 64651.746 Da / Num. of mol.: 1 / Source: (gene. exp.) Homo sapiens (human) / Gene: NELFCD, NELFD, TH1, TH1L, HSPC130 / Production host: Trichoplusia ni (cabbage looper) / References: UniProt: Q8IXH7
#17: Protein/peptide Negative elongation factor E / NELF-E / RNA-binding protein RD


Mass: 45363.449 Da / Num. of mol.: 1 / Source: (gene. exp.) Homo sapiens (human) / Gene: NELFE, RD, RDBP / Production host: Trichoplusia ni (cabbage looper) / References: UniProt: P18615

+
Transcription elongation factor ... , 2 types, 2 molecules YZ

#18: Protein/peptide Transcription elongation factor SPT4 / hSPT4 / DRB sensitivity-inducing factor 14 kDa subunit / DSIF p14 / DRB sensitivity-inducing factor small subunit / DSIF small subunit


Mass: 13555.891 Da / Num. of mol.: 1 / Source: (gene. exp.) Homo sapiens (human) / Gene: SUPT4H1, SPT4H, SUPT4H / Production host: Escherichia coli BL21(DE3) (bacteria) / Variant (production host): RIL / References: UniProt: P63272
#19: Protein/peptide Transcription elongation factor SPT5 / hSPT5 / DRB sensitivity-inducing factor 160 kDa subunit / DSIF p160 / DRB sensitivity-inducing factor large subunit / DSIF large subunit / Tat-cotransactivator 1 protein / Tat-CT1 protein


Mass: 121145.477 Da / Num. of mol.: 1 / Source: (gene. exp.) Homo sapiens (human) / Gene: SUPT5H, SPT5, SPT5H / Production host: Escherichia coli BL21(DE3) (bacteria) / Variant (production host): RIL / References: UniProt: O00267

+
Protein/peptide / RNA chain , 2 types, 2 molecules HP

#12: RNA chain TAR RNA


Mass: 14746.812 Da / Num. of mol.: 1 / Source: (synth.) Human immunodeficiency virus 1
#6: Protein/peptide DNA-directed RNA polymerases I, II, and III subunit RPABC3 / RNA polymerase


Mass: 17162.273 Da / Num. of mol.: 1 / Source: (natural) Sus scrofa (pig) / Organ: Thymus / References: UniProt: I3LCB2

+
Non-polymers , 2 types, 10 molecules

#22: Chemical ChemComp-MG / MAGNESIUM ION


Mass: 24.305 Da / Num. of mol.: 1 / Formula: Mg / Magnesium
#23: Chemical
ChemComp-ZN / ZINC ION


Mass: 65.409 Da / Num. of mol.: 9 / Formula: Zn / Zinc

-
Experimental details

-
Experiment

ExperimentMethod: ELECTRON MICROSCOPY
EM experimentAggregation state: PARTICLE / Reconstruction method: single particle reconstruction

-
Sample preparation

Component
IDNameTypeEntity IDParent IDSource
1RNA Polymerase II elongation complex bound to DSIF and NELFCOMPLEX1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 210MULTIPLE SOURCES
2Sus scrofa RNA Polymerase IICOMPLEX1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 211NATURAL
3Negative elongation factor (NELF)COMPLEX14, 15, 16, 171RECOMBINANT
4DRB sensitivity inducing factor (DSIF)COMPLEX18, 191RECOMBINANT
5HIV-1 pause transcription scaffoldCOMPLEX11, 12, 131RECOMBINANT
Molecular weightValue: .9271 MDa / Experimental value: NO
Source (natural)
IDEntity assembly IDNcbi tax IDOrganism
129823Sus scrofa (pig)
239606Homo sapiens (human)
3511676Human immunodeficiency virus 1
4411676Human immunodeficiency virus 1
Source (recombinant)
IDEntity assembly IDNcbi tax IDOrganism
137111Trichoplusia ni (cabbage looper)
2532630synthetic construct (others)
34469008Escherichia coli BL21(DE3) (bacteria)
Buffer solutionpH: 7.4
SpecimenConc.: 0.2 mg/ml / Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES
Specimen supportGrid material: GOLD / Grid type: Quantifoil UltrAuFoil
VitrificationInstrument: FEI VITROBOT MARK IV / Cryogen name: ETHANE / Humidity: 100 % / Chamber temperature: 277 kelvins

-
Electron microscopy imaging

Experimental equipment
Model: Titan Krios / Image courtesy: FEI Company
MicroscopyMicroscope model: FEI TITAN KRIOS
Electron gunElectron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: SPOT SCAN
Electron lensMode: BRIGHT FIELDBright-field microscopy / Nominal magnification: 165000 / Alignment procedure: COMA FREE
Specimen holderCryogen: NITROGEN / Specimen holder model: FEI TITAN KRIOS AUTOGRID HOLDER
Image recordingAverage exposure time: 9 sec. / Electron dose: 46 e/Å2 / Detector mode: COUNTING / Film or detector model: GATAN K2 QUANTUM (4k x 4k) / Number of real images: 11740
EM imaging opticsEnergyfilter name: GIF Quantum LS / Energyfilter slit width: 20 eV
Image scansMovie frames/image: 36

-
Processing

SoftwareName: PHENIX / Version: 1.13_2998: / Classification: refinement
EM software
IDNameVersionCategory
2EPUimage acquisition
13RELION2.13D reconstruction
CTF correctionType: PHASE FLIPPING AND AMPLITUDE CORRECTION
SymmetryPoint symmetry: C1
3D reconstructionResolution: 3.2 Å / Resolution method: FSC 0.143 CUT-OFF / Number of particles: 162269 / Symmetry type: POINT

+
About Yorodumi

-
News

-
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary. This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated. See below links for details.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software). Now, EM Navigator and Yorodumi are based on the updated data.

External links: wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Jun 16, 2017. Omokage search with filter

Omokage search with filter

  • Result of Omokage search can be filtered by keywords and the database types

Related info.: Omokage search

+
Sep 15, 2016. EM Navigator & Yorodumi renewed

EM Navigator & Yorodumi renewed

  • New versions of EM Navigator and Yorodumi started

Related info.: Changes in new EM Navigator and Yorodumi

+
Aug 31, 2016. New EM Navigator & Yorodumi

New EM Navigator & Yorodumi

  • In 15th Sep 2016, the development versions of EM Navigator and Yorodumi will replace the official versions.
  • Current version will continue as 'legacy version' for some time.

Related info.: Changes in new EM Navigator and Yorodumi / EM Navigator / Yorodumi

+
Apr 13, 2016. Omokage search got faster

Omokage search got faster

  • The computation time became ~1/2 compared to the previous version by re-optimization of data accession
  • Enjoy "shape similarity" of biomolecules, more!

Related info.: Omokage search

Read more

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.

Related info.: EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more