[English] 日本語
Yorodumi
- PDB-6gml: Structure of paused transcription complex Pol II-DSIF-NELF -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 6gml
TitleStructure of paused transcription complex Pol II-DSIF-NELF
Components
  • (DNA-directed RNA polymerase ...Polymerase) x 3
  • (Negative elongation factor ...) x 4
  • (RNA polymerase II subunit ...) x 5
  • (Transcription elongation factor ...) x 2
  • (Uncharacterized ...) x 3
  • DNA-directed RNA polymerases I, II, and III subunit RPABC3RNA polymerase
  • Non-template DNA
  • TAR RNA
  • Template DNA
KeywordsTRANSCRIPTION / RNA polymerase II / pausing / NELF / DSIF
Function / homology
Function and homology information


NELF complex / negative regulation of DNA-templated transcription, elongation / DSIF complex / negative regulation of mRNA polyadenylation / positive regulation of DNA-templated transcription, elongation / negative regulation of transcription elongation from RNA polymerase II promoter / negative regulation of stem cell differentiation / nuclear-transcribed mRNA catabolic process, exonucleolytic / positive regulation of viral transcription / recruitment of 3'-end processing factors to RNA polymerase II holoenzyme complex ...NELF complex / negative regulation of DNA-templated transcription, elongation / DSIF complex / negative regulation of mRNA polyadenylation / positive regulation of DNA-templated transcription, elongation / negative regulation of transcription elongation from RNA polymerase II promoter / negative regulation of stem cell differentiation / nuclear-transcribed mRNA catabolic process, exonucleolytic / positive regulation of viral transcription / recruitment of 3'-end processing factors to RNA polymerase II holoenzyme complex / mRNA export from nucleus in response to heat stress / maintenance of transcriptional fidelity during DNA-templated transcription elongation from RNA polymerase II promoter / RNA polymerase II activity / positive regulation of histone H3-K4 methylation / positive regulation of nuclear-transcribed mRNA poly(A) tail shortening / nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay / RNA polymerase II complex binding / positive regulation of translational initiation / core promoter binding / RNA polymerase I complex / RNA polymerase III complex / mRNA cleavage / nuclear euchromatin / RNA polymerase II, core complex / transcription by RNA polymerase I / transcription by RNA polymerase III / 7-methylguanosine mRNA capping / positive regulation of macroautophagy / translation initiation factor binding / stem cell differentiation / transcription elongation from RNA polymerase II promoter / ribonucleoside binding / single-stranded RNA binding / DNA-directed 5'-3' RNA polymerase activity / DNA-directed RNA polymerase / P-body / microtubule cytoskeleton / transcription-coupled nucleotide-excision repair / single-stranded DNA binding / chromatin organization / cell population proliferation / transcription by RNA polymerase II / nuclear chromosome, telomeric region / transcription initiation from RNA polymerase II promoter / nuclear body / nucleic acid binding / chromatin remodeling / positive regulation of ERK1 and ERK2 cascade / multicellular organism development / protein dimerization activity / nuclear speck / mRNA binding / regulation of transcription by RNA polymerase II / nucleolus / chromatin binding / DNA-binding transcription factor activity / regulation of transcription, DNA-templated / nucleotide binding / protein heterodimerization activity / negative regulation of transcription by RNA polymerase II / enzyme binding / positive regulation of transcription by RNA polymerase II / RNA binding / DNA binding / zinc ion binding / membrane / nucleoplasm / plasma membrane / nucleus / cytosol / cytoplasm
RNA polymerase, subunit H/Rpb5, conserved site / RNA polymerase Rpb2, OB-fold / DNA-directed RNA polymerase, insert domain / DNA-directed RNA polymerase, RpoA/D/Rpb3-type / DNA-directed RNA polymerase subunit/transcription factor S / RNA polymerase subunit, RPB6/omega / Nucleic acid-binding, OB-fold / Nucleotide-binding alpha-beta plait domain superfamily / DNA-directed RNA polymerase RPB5 subunit, eukaryote/virus / Ribosomal protein L2, domain 2 ...RNA polymerase, subunit H/Rpb5, conserved site / RNA polymerase Rpb2, OB-fold / DNA-directed RNA polymerase, insert domain / DNA-directed RNA polymerase, RpoA/D/Rpb3-type / DNA-directed RNA polymerase subunit/transcription factor S / RNA polymerase subunit, RPB6/omega / Nucleic acid-binding, OB-fold / Nucleotide-binding alpha-beta plait domain superfamily / DNA-directed RNA polymerase RPB5 subunit, eukaryote/virus / Ribosomal protein L2, domain 2 / DNA-directed RNA polymerase, subunit 2 / Cofactor of BRCA1 / Transcription elongation factor Spt5, eukaryote / DNA-directed RNA polymerase M, 15kDa subunit, conserved site / RNA polymerase Rpb2, domain 3 / Archaeal RpoH /eukaryotic RPB5 RNA polymerase subunit / DNA-directed RNA polymerase, 14-18kDa subunit, conserved site / Spt5 transcription elongation factor, N-terminal / Spt4/RpoE2 zinc finger / RNA-binding domain, S1 / HRDC-like superfamily / Transcription initiation Spt4 / Negative elongation factor A / DNA-directed RNA polymerase, subunit 2, hybrid-binding domain / NusG, N-terminal / TH1 protein / RNA polymerase Rpb1, domain 3 / RNA polymerase Rpb1, domain 7 / RNA polymerase Rpb1, domain 6 / RNA polymerase Rpb1, domain 1 / RNA polymerase Rpb1, domain 5 / RNA polymerase Rpb1, domain 4 / RNA polymerase, beta subunit, conserved site / DNA-directed RNA polymerase, RBP11-like dimerisation domain / RNA polymerase Rpb2, domain 7 / RNA polymerase Rpb2, domain 2 / RNA polymerase, beta subunit, protrusion / RNA polymerase Rpb2, domain 3 / RNA polymerase Rpb2, domain 4 / RNA polymerase Rpb2, domain 5 / DNA-directed RNA polymerase Rpb11, 13-16kDa subunit, conserved site / Translation protein SH3-like domain superfamily / Spt5 C-terminal domain / DNA-directed RNA polymerase, subunit RPB6 / RNA polymerase archaeal subunit P/eukaryotic subunit RPABC4 / RNA polymerase beta subunit / DNA-directed RNA polymerases I, II, and III subunit RPABC4 / Spt5, KOW domain repeat 1 / Spt5, KOW domain repeat 2 / Spt5, KOW domain repeat 3 / Spt5, KOW domain repeat 4 / Spt5, KOW domain repeat 5 / Spt5, KOW domain repeat 6 / RNA polymerase Rpb1, domain 3 superfamily / RNA polymerase Rpb2, domain 2 / DNA-directed RNA polymerase subunit Rpb5-like / RNA polymerase Rpb2, domain 7 / RNA polymerase Rpb2, domain 6 / RNA polymerase Rpb1 C-terminal repeat / RNA polymerase Rpb1, domain 4 / RNA polymerase Rpb1, domain 5 / RNA polymerase Rpb1, domain 1 / RNA polymerase Rpb1, domain 6 / RNA polymerase Rpb1, domain 7 / Transcription elongation factor SPT5 / NGN domain, eukaryotic / RNA polymerase subunit RPABC4/transcription elongation factor Spt4 / RNA polymerase Rpb5, N-terminal domain superfamily / Negative elongation factor E / Pol II subunit B9, C-terminal zinc ribbon / Negative elongation factor E, RNA recognition motif / RPB5-like RNA polymerase subunit superfamily / RNA-binding domain superfamily / RPB6/omega subunit-like superfamily / RNA polymerase, RBP11-like subunit / DNA-directed RNA polymerase, insert domain superfamily / NusG, N-terminal domain superfamily / RNA polymerase Rpb1, domain 7 superfamily / RNA polymerase Rpb7-like, N-terminal domain superfamily / DNA-directed RNA polymerase, subunit 2, hybrid-binding domain superfamily / RNA polymerase Rpb2, domain 2 superfamily / Hepatitis delta antigen (HDAg) domain / RNA polymerase RBP11 / RNA polymerase Rpb1, funnel domain superfamily / Rpb4/RPC9 superfamily / Spt4 superfamily / RNA polymerase, N-terminal / RNA polymerase Rpb4/RPC9, core / RNA polymerase Rpb1, domain 2 / RNA polymerases M/15 Kd subunit / RNA polymerase Rpb3/Rpb11 dimerisation domain / RNA polymerase Rpb5, C-terminal domain / RNA polymerase Rpb5, N-terminal domain / RNA polymerase Rpb6 / S1 RNA binding domain / SHS2 domain found in N terminus of Rpb7p/Rpc25p/MJ0397 / Archaeal RpoK/eukaryotic RPB6 RNA polymerase subunit / Transcription factor S-II (TFIIS) / RNA polymerase Rpb3/Rpb11 dimerisation domain / RNA polymerase Rpb2, domain 5
Negative elongation factor B / Negative elongation factor C/D / RNA polymerase II subunit K / Negative elongation factor A / Negative elongation factor E / Transcription elongation factor SPT5 / RNA polymerase II subunit G / Transcription elongation factor SPT4 / RNA polymerase II subunit E / RNA polymerase II subunit D ...Negative elongation factor B / Negative elongation factor C/D / RNA polymerase II subunit K / Negative elongation factor A / Negative elongation factor E / Transcription elongation factor SPT5 / RNA polymerase II subunit G / Transcription elongation factor SPT4 / RNA polymerase II subunit E / RNA polymerase II subunit D / DNA-directed RNA polymerase II subunit RPB11-a / RNA polymerase II subunit F / DNA-directed RNA polymerases I, II, and III subunit RPABC3 / DNA-directed RNA polymerase II subunit RPB3 / DNA-directed RNA polymerase subunit beta / DNA-directed RNA polymerase subunit / DNA-directed RNA polymerase II subunit RPB9
Biological speciesHomo sapiens (human)
Sus scrofa (pig)
Human immunodeficiency virus 1
MethodELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 3.2 Å
AuthorsVos, S.M. / Farnung, L. / Urlaub, H. / Cramer, P.
Funding support Germany, 3items
OrganizationGrant numberCountry
European Molecular Biology OrganizationALTF-725-2014 Germany
German Research FoundationDFG SFB860 Germany
European Research Council693023 Germany
CitationJournal: Nature / Year: 2018
Title: Structure of paused transcription complex Pol II-DSIF-NELF.
Authors: Seychelle M Vos / Lucas Farnung / Henning Urlaub / Patrick Cramer /
Abstract: Metazoan gene regulation often involves the pausing of RNA polymerase II (Pol II) in the promoter-proximal region. Paused Pol II is stabilized by the protein complexes DRB sensitivity-inducing factor ...Metazoan gene regulation often involves the pausing of RNA polymerase II (Pol II) in the promoter-proximal region. Paused Pol II is stabilized by the protein complexes DRB sensitivity-inducing factor (DSIF) and negative elongation factor (NELF). Here we report the cryo-electron microscopy structure of a paused transcription elongation complex containing Sus scrofa Pol II and Homo sapiens DSIF and NELF at 3.2 Å resolution. The structure reveals a tilted DNA-RNA hybrid that impairs binding of the nucleoside triphosphate substrate. NELF binds the polymerase funnel, bridges two mobile polymerase modules, and contacts the trigger loop, thereby restraining Pol II mobility that is required for pause release. NELF prevents binding of the anti-pausing transcription elongation factor IIS (TFIIS). Additionally, NELF possesses two flexible 'tentacles' that can contact DSIF and exiting RNA. These results define the paused state of Pol II and provide the molecular basis for understanding the function of NELF during promoter-proximal gene regulation.
Validation Report
SummaryFull reportAbout validation report
History
DepositionMay 27, 2018Deposition site: PDBE / Processing site: PDBE
Revision 1.0Sep 5, 2018Provider: repository / Type: Initial release
Revision 1.1Sep 12, 2018Group: Data collection / Database references / Category: citation
Item: _citation.journal_volume / _citation.page_first / _citation.page_last
Revision 1.2Oct 3, 2018Group: Data collection / Experimental preparation / Category: em_sample_support / Item: _em_sample_support.grid_type
Revision 2.0Jan 23, 2019Group: Advisory / Data collection ...Advisory / Data collection / Database references / Polymer sequence / Source and taxonomy / Structure summary
Category: em_entity_assembly / entity ...em_entity_assembly / entity / entity_name_com / entity_poly / entity_poly_seq / entity_src_gen / pdbx_poly_seq_scheme / pdbx_unobs_or_zero_occ_residues / struct_ref / struct_ref_seq / struct_ref_seq_dif
Item: _em_entity_assembly.entity_id_list / _entity.formula_weight ..._em_entity_assembly.entity_id_list / _entity.formula_weight / _entity.pdbx_description / _entity_poly.nstd_monomer / _entity_poly.pdbx_seq_one_letter_code / _entity_poly.pdbx_seq_one_letter_code_can
Revision 2.1Dec 11, 2019Group: Other / Category: atom_sites / cell
Item: _atom_sites.fract_transf_matrix[1][1] / _atom_sites.fract_transf_matrix[2][2] ..._atom_sites.fract_transf_matrix[1][1] / _atom_sites.fract_transf_matrix[2][2] / _atom_sites.fract_transf_matrix[3][3] / _cell.Z_PDB

-
Structure visualization

Movie
  • Deposited structure unit
  • Imaged by Jmol
  • Download
  • Superimposition on EM map
  • EMDB-0038
  • Imaged by UCSF Chimera
  • Download
Movie viewer
Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
A: DNA-directed RNA polymerase subunit
B: DNA-directed RNA polymerase subunit beta
C: RNA polymerase II subunit C
E: RNA polymerase II subunit E
F: RNA polymerase II subunit F
H: DNA-directed RNA polymerases I, II, and III subunit RPABC3
I: DNA-directed RNA polymerase II subunit RPB9
J: Uncharacterized protein
K: Uncharacterized protein
L: Uncharacterized protein
N: Non-template DNA
P: TAR RNA
T: Template DNA
U: Negative elongation factor A
V: Negative elongation factor B,Negative elongation factor B
W: Negative elongation factor C/D
X: Negative elongation factor E,Negative elongation factor E
Y: Transcription elongation factor SPT4
Z: Transcription elongation factor SPT5
D: RNA polymerase II subunit D
G: RNA polymerase II subunit G
hetero molecules


Theoretical massNumber of molelcules
Total (without water)928,51631
Polymers927,90321
Non-polymers61310
Water0
1


TypeNameSymmetry operationNumber
identity operation1_5551

-
Components

+
DNA-directed RNA polymerase ... , 3 types, 3 molecules ABI

#1: Protein/peptide DNA-directed RNA polymerase subunit / Polymerase


Mass: 217450.078 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Sus scrofa (pig) / Organ: Thymus
References: UniProt: I3LJR4*PLUS, DNA-directed RNA polymerase
#2: Protein/peptide DNA-directed RNA polymerase subunit beta / Polymerase


Mass: 134041.422 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Sus scrofa (pig) / Organ: Thymus / References: UniProt: I3LGP4, DNA-directed RNA polymerase
#7: Protein/peptide DNA-directed RNA polymerase II subunit RPB9 / Polymerase / RNA polymerase II subunit B9 / DNA-directed RNA polymerase II subunit I / RNA polymerase II 14.5 ...RNA polymerase II subunit B9 / DNA-directed RNA polymerase II subunit I / RNA polymerase II 14.5 kDa subunit / RPB14.5


Mass: 14541.221 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Sus scrofa (pig) / Organ: Thymus / References: UniProt: P60899

+
RNA polymerase II subunit ... , 5 types, 5 molecules CEFDG

#3: Protein/peptide RNA polymerase II subunit C /


Mass: 30997.557 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Sus scrofa (pig) / Organ: Thymus / References: UniProt: I3LCH3
#4: Protein/peptide RNA polymerase II subunit E /


Mass: 24644.318 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Sus scrofa (pig) / Organ: Thymus / References: UniProt: I3LSI7
#5: Protein/peptide RNA polymerase II subunit F /


Mass: 14477.001 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Sus scrofa (pig) / References: UniProt: F1SKN8
#20: Protein/peptide RNA polymerase II subunit D /


Mass: 16331.255 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Sus scrofa (pig) / Organ: Thymus / References: UniProt: A0A287ADR4
#21: Protein/peptide RNA polymerase II subunit G /


Mass: 19314.283 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Sus scrofa (pig) / Organ: Thymus / References: UniProt: I3LJZ9

+
Uncharacterized ... , 3 types, 3 molecules JKL

#8: Protein/peptide Uncharacterized protein


Mass: 7655.123 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Sus scrofa (pig) / Organ: Thymus
#9: Protein/peptide Uncharacterized protein


Mass: 13310.284 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Sus scrofa (pig) / Organ: Thymus / References: UniProt: F1RKE4
#10: Protein/peptide Uncharacterized protein


Mass: 7018.244 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Sus scrofa (pig) / Organ: Thymus / References: UniProt: I3LN51

+
DNA chain , 2 types, 2 molecules NT

#11: DNA chain Non-template DNA


Mass: 14712.466 Da / Num. of mol.: 1
Mutation: bases 1-23 mutated, original sequence: CTCTGGCTATCTAGGGAACCCTC
Source method: obtained synthetically / Source: (synth.) Human immunodeficiency virus 1
Details: mutated from original sequence for structural work
#13: DNA chain Template DNA


Mass: 14910.556 Da / Num. of mol.: 1
Mutation: Bases 35-48 were mutated from ATAGATAGCCAGAG to AGGTACTAGTGTAC
Source method: obtained synthetically / Source: (synth.) Human immunodeficiency virus 1

+
Negative elongation factor ... , 4 types, 4 molecules UVWX

#14: Protein/peptide Negative elongation factor A / NELF-A / Wolf-Hirschhorn syndrome candidate 2 protein


Mass: 57343.598 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: NELFA, WHSC2, P/OKcl.15 / Production host: Trichoplusia ni (cabbage looper) / References: UniProt: Q9H3P2
#15: Protein/peptide Negative elongation factor B,Negative elongation factor B / NELF-B / Cofactor of BRCA1


Mass: 64577.230 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: NELFB, COBRA1, KIAA1182 / Production host: Trichoplusia ni (cabbage looper) / References: UniProt: Q8WX92
#16: Protein/peptide Negative elongation factor C/D / NELF-C/D / TH1-like protein


Mass: 64651.746 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: NELFCD, NELFD, TH1, TH1L, HSPC130 / Production host: Trichoplusia ni (cabbage looper) / References: UniProt: Q8IXH7
#17: Protein/peptide Negative elongation factor E,Negative elongation factor E / NELF-E / RNA-binding protein RD


Mass: 45363.449 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: NELFE, RD, RDBP / Production host: Trichoplusia ni (cabbage looper) / References: UniProt: P18615

+
Transcription elongation factor ... , 2 types, 2 molecules YZ

#18: Protein/peptide Transcription elongation factor SPT4 / hSPT4 / DRB sensitivity-inducing factor 14 kDa subunit / DSIF p14 / DRB sensitivity-inducing factor ...hSPT4 / DRB sensitivity-inducing factor 14 kDa subunit / DSIF p14 / DRB sensitivity-inducing factor small subunit / DSIF small subunit


Mass: 13508.496 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: SUPT4H1, SPT4H, SUPT4H / Production host: Escherichia coli BL21(DE3) (bacteria) / Variant (production host): RIL / References: UniProt: P63272
#19: Protein/peptide Transcription elongation factor SPT5 / hSPT5 / DRB sensitivity-inducing factor 160 kDa subunit / DSIF p160 / DRB sensitivity-inducing ...hSPT5 / DRB sensitivity-inducing factor 160 kDa subunit / DSIF p160 / DRB sensitivity-inducing factor large subunit / DSIF large subunit / Tat-cotransactivator 1 protein / Tat-CT1 protein


Mass: 121145.477 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: SUPT5H, SPT5, SPT5H / Production host: Escherichia coli BL21(DE3) (bacteria) / Variant (production host): RIL / References: UniProt: O00267

+
Protein/peptide / RNA chain , 2 types, 2 molecules HP

#12: RNA chain TAR RNA


Mass: 14746.812 Da / Num. of mol.: 1 / Source method: obtained synthetically / Source: (synth.) Human immunodeficiency virus 1
#6: Protein/peptide DNA-directed RNA polymerases I, II, and III subunit RPABC3 / RNA polymerase


Mass: 17162.273 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Sus scrofa (pig) / Organ: Thymus / References: UniProt: I3LCB2

+
Non-polymers , 2 types, 10 molecules

#22: Chemical ChemComp-MG / MAGNESIUM ION / Magnesium


Mass: 24.305 Da / Num. of mol.: 1 / Source method: obtained synthetically / Formula: Mg
#23: Chemical
ChemComp-ZN / ZINC ION / Zinc


Mass: 65.409 Da / Num. of mol.: 9 / Source method: obtained synthetically / Formula: Zn

-
Experimental details

-
Experiment

ExperimentMethod: ELECTRON MICROSCOPY
EM experimentAggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction

-
Sample preparation

Component

Type: COMPLEX

IDNameEntity IDParent-IDSource
1RNA Polymerase II elongation complex bound to DSIF and NELF2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,19,20,210MULTIPLE SOURCES
2Sus scrofa RNA Polymerase II2,3,4,5,6,7,8,9,10,20,211NATURAL
3Negative elongation factor (NELF)14,15,16,171RECOMBINANT
4DRB sensitivity inducing factor (DSIF)191RECOMBINANT
5HIV-1 pause transcription scaffold11,12,131RECOMBINANT
Molecular weightValue: .9271 MDa / Experimental value: NO
Source (natural)
IDEntity assembly-IDOrganismNcbi tax-ID
12Sus scrofa (pig)9823
23Homo sapiens (human)9606
35Human immunodeficiency virus 111676
44Human immunodeficiency virus 111676
Source (recombinant)
IDEntity assembly-IDOrganismNcbi tax-ID
13Trichoplusia ni (cabbage looper)7111
25synthetic construct (others)32630
34Escherichia coli BL21(DE3) (bacteria)469008
Buffer solutionpH: 7.4
SpecimenConc.: 0.2 mg/ml / Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES
Specimen supportGrid material: GOLD / Grid type: Quantifoil UltrAuFoil
VitrificationInstrument: FEI VITROBOT MARK IV / Cryogen name: ETHANE / Humidity: 100 % / Chamber temperature: 277 K

-
Electron microscopy imaging

Experimental equipment
Model: Titan Krios / Image courtesy: FEI Company
MicroscopyModel: FEI TITAN KRIOS
Electron gunElectron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: SPOT SCAN
Electron lensMode: BRIGHT FIELDBright-field microscopy / Nominal magnification: 165000 X / Alignment procedure: COMA FREE
Specimen holderCryogen: NITROGEN / Model: FEI TITAN KRIOS AUTOGRID HOLDER
Image recordingAverage exposure time: 9 sec. / Electron dose: 46 e/Å2 / Detector mode: COUNTING / Film or detector model: GATAN K2 QUANTUM (4k x 4k) / Num. of real images: 11740
EM imaging opticsEnergyfilter name: GIF Quantum LS / Energyfilter slit width: 20 eV
Image scansMovie frames/image: 36

-
Processing

SoftwareName: PHENIX / Version: 1.13_2998: / Classification: refinement
EM software
IDNameVersionCategory
2EPUimage acquisition
13RELION2.13D reconstruction
CTF correctionType: PHASE FLIPPING AND AMPLITUDE CORRECTION
SymmetryPoint symmetry: C1 (asymmetric)
3D reconstructionResolution: 3.2 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 162269 / Symmetry type: POINT

+
About Yorodumi

-
News

-
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force. (see PDBe EMDB page)
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.: Q: What is "EMD"? / ID/Accession-code notation in Yorodumi/EM Navigator

External links: EMDB at PDBe / Contact to PDBj

-
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary. This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated. See below links for details.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software). Now, EM Navigator and Yorodumi are based on the updated data.

External links: wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

+
Jun 16, 2017. Omokage search with filter

Omokage search with filter

  • Result of Omokage search can be filtered by keywords and the database types

Related info.: Omokage search

+
Sep 15, 2016. EM Navigator & Yorodumi renewed

EM Navigator & Yorodumi renewed

  • New versions of EM Navigator and Yorodumi started

Related info.: Changes in new EM Navigator and Yorodumi

+
Aug 31, 2016. New EM Navigator & Yorodumi

New EM Navigator & Yorodumi

  • In 15th Sep 2016, the development versions of EM Navigator and Yorodumi will replace the official versions.
  • Current version will continue as 'legacy version' for some time.

Related info.: Changes in new EM Navigator and Yorodumi / EM Navigator / Yorodumi

Read more

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.

Related info.: EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more