[English] 日本語
Yorodumi
- PDB-6gml: Structure of paused transcription complex Pol II-DSIF-NELF -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 6gml
TitleStructure of paused transcription complex Pol II-DSIF-NELF
Components
  • (DNA-directed RNA polymerase ...) x 3
  • (Negative elongation factor ...) x 4
  • (RNA polymerase II subunit ...) x 5
  • (Transcription elongation factor ...) x 2
  • (Uncharacterized ...) x 3
  • DNA-directed RNA polymerases I, II, and III subunit RPABC3
  • Non-template DNA
  • TAR RNA
  • Template DNA
KeywordsTRANSCRIPTION / RNA polymerase II / pausing / NELF / DSIF
Function / homology
Function and homology information


NELF complex / NTRK3 as a dependence receptor / negative regulation of DNA-templated transcription, elongation / : / DSIF complex / regulation of transcription elongation by RNA polymerase II / Formation of RNA Pol II elongation complex / Formation of the Early Elongation Complex / Transcriptional regulation by small RNAs / RNA Polymerase II Pre-transcription Events ...NELF complex / NTRK3 as a dependence receptor / negative regulation of DNA-templated transcription, elongation / : / DSIF complex / regulation of transcription elongation by RNA polymerase II / Formation of RNA Pol II elongation complex / Formation of the Early Elongation Complex / Transcriptional regulation by small RNAs / RNA Polymerase II Pre-transcription Events / TP53 Regulates Transcription of DNA Repair Genes / FGFR2 alternative splicing / RNA polymerase II transcribes snRNA genes / mRNA Capping / mRNA Splicing - Minor Pathway / Processing of Capped Intron-Containing Pre-mRNA / RNA Polymerase II Promoter Escape / RNA Polymerase II Transcription Pre-Initiation And Promoter Opening / RNA Polymerase II Transcription Initiation / RNA Polymerase II Transcription Elongation / RNA Polymerase II Transcription Initiation And Promoter Clearance / RNA Pol II CTD phosphorylation and interaction with CE / Estrogen-dependent gene expression / Formation of TC-NER Pre-Incision Complex / Dual incision in TC-NER / Gap-filling DNA repair synthesis and ligation in TC-NER / mRNA Splicing - Major Pathway / negative regulation of stem cell differentiation / positive regulation of DNA-templated transcription, elongation / Abortive elongation of HIV-1 transcript in the absence of Tat / transcription elongation-coupled chromatin remodeling / RNA Pol II CTD phosphorylation and interaction with CE during HIV infection / RNA Pol II CTD phosphorylation and interaction with CE / positive regulation of nuclear-transcribed mRNA poly(A) tail shortening / Formation of the Early Elongation Complex / Formation of the HIV-1 Early Elongation Complex / mRNA Capping / organelle membrane / negative regulation of transcription elongation by RNA polymerase II / RNA polymerase II complex binding / maintenance of transcriptional fidelity during transcription elongation by RNA polymerase II / Pausing and recovery of Tat-mediated HIV elongation / Tat-mediated HIV elongation arrest and recovery / positive regulation of macroautophagy / positive regulation of translational initiation / RNA polymerase II transcribes snRNA genes / HIV elongation arrest and recovery / Pausing and recovery of HIV elongation / Tat-mediated elongation of the HIV-1 transcript / Formation of HIV-1 elongation complex containing HIV-1 Tat / transcription by RNA polymerase III / transcription by RNA polymerase I / RNA polymerase I complex / transcription elongation by RNA polymerase I / Formation of HIV elongation complex in the absence of HIV Tat / RNA polymerase III complex / transcription-coupled nucleotide-excision repair / core promoter sequence-specific DNA binding / RNA polymerase II, core complex / tRNA transcription by RNA polymerase III / : / RNA Polymerase II Transcription Elongation / Formation of RNA Pol II elongation complex / translation initiation factor binding / RNA Polymerase II Pre-transcription Events / DNA-directed RNA polymerase activity / stem cell differentiation / transcription initiation at RNA polymerase II promoter / TP53 Regulates Transcription of DNA Repair Genes / transcription elongation by RNA polymerase II / P-body / euchromatin / ribonucleoside binding / : / : / : / : / : / : / fibrillar center / DNA-directed RNA polymerase / single-stranded DNA binding / molecular adaptor activity / transcription by RNA polymerase II / nucleic acid binding / chromosome, telomeric region / cell population proliferation / single-stranded RNA binding / positive regulation of ERK1 and ERK2 cascade / protein dimerization activity / nuclear speck / nuclear body / protein heterodimerization activity / RNA-directed RNA polymerase activity / nucleotide binding / mRNA binding / chromatin binding / regulation of DNA-templated transcription / chromatin / nucleolus
Similarity search - Function
Herpes Virus-1 - #210 / Negative elongation factor E / Negative elongation factor E, RNA recognition motif / Cofactor of BRCA1 / Cofactor of BRCA1 (COBRA1) / : / NELF-A N-terminal domain / TH1 protein / TH1 protein / Hepatitis delta antigen (HDAg) domain ...Herpes Virus-1 - #210 / Negative elongation factor E / Negative elongation factor E, RNA recognition motif / Cofactor of BRCA1 / Cofactor of BRCA1 (COBRA1) / : / NELF-A N-terminal domain / TH1 protein / TH1 protein / Hepatitis delta antigen (HDAg) domain / Hepatitis delta antigen (HDAg) domain profile. / RNA Polymerase II, Rpb4 subunit / Spt5, KOW domain repeat 6 / Transcription elongation factor SPT5, seventh KOW domain / Transcription elongation factor SPT5, sixth KOW domain / RNA polymerase Rpb7-like, N-terminal domain / Transcription initiation Spt4 / Spt4 superfamily / Spt4/RpoE2 zinc finger / Spt4/RpoE2 zinc finger / Spt4/RpoE2 zinc finger / Transcription elongation factor SPT5, second KOW domain / Transcription elongation factor SPT5, fifth KOW domain / Transcription elongation factor SPT5, KOWx domain / Transcription elongation factor SPT5, KOW1 domain / Transcription elongation factor SPT5, fourth KOW domain / Transcription elongation factor Spt5, eukaryote / Spt5 transcription elongation factor, N-terminal / Spt5, KOW domain repeat 2 / Spt5, KOW domain repeat 3 / Spt5, KOW domain repeat 5 / Spt5 transcription elongation factor, acidic N-terminal / NGN domain, eukaryotic / Spt5, KOW domain repeat 1 / Spt5, KOW domain repeat 4 / Dna-directed Rna Polymerases I, Ii, And Iii 27 Kd Polypeptide; Chain: A; domain 1 / RNA polymerase, Rpb5, N-terminal domain / RNA-binding domain, S1 / Spt5 C-terminal domain / Spt5 C-terminal nonapeptide repeat binding Spt4 / RNA polymerase ii, chain L / NGN domain / Transcription elongation factor SPT5 / Early transcription elongation factor of RNA pol II, NGN section / Gyrase A; domain 2 - #140 / RPB5-like RNA polymerase subunit / N-terminal domain of TfIIb - #10 / Dna-directed Rna Polymerase Ii 140kd Polypeptide; Chain: B; domain 3 / RNA polymerase Rpb2, domain 2 / NusG, N-terminal / In Spt5p, this domain may confer affinity for Spt4p. It possesses a RNP-like fold. / RNA polymerase subunit, RPB6/omega / Eukaryotic RPB6 RNA polymerase subunit / RNA polymerase Rpb1, domain 3 / RNA polymerase, RBP11-like subunit / NusG, N-terminal domain superfamily / Enzyme I; Chain A, domain 2 / N-terminal domain of TfIIb / Rubrerythrin, domain 2 / Growth Hormone; Chain: A; / DNA-directed RNA polymerase, insert domain / RNA Polymerase Alpha Subunit; Chain A, domain 2 / DNA-directed RNA polymerase II subunit Rpb4-like / RNA polymerase Rpb1 C-terminal repeat / RNA polymerase II, heptapeptide repeat, eukaryotic / Eukaryotic RNA polymerase II heptapeptide repeat. / RNA polymerase Rpb1, domain 6 / RNA polymerase Rpb1, domain 6 / RNA polymerase Rpb4/RPC9, core / DNA-directed RNA-polymerase II subunit / Herpes Virus-1 / RNA polymerase Rpb1, domain 7 / RNA polymerase Rpb1, domain 7 superfamily / RNA polymerase Rpb1, domain 7 / Pol II subunit B9, C-terminal zinc ribbon / Gyrase A; domain 2 / RNA polymerase RBP11 / Rpb4/RPC9 superfamily / RNA polymerase subunit Rpb4/RPC9 / RNA polymerase Rpb4 / Homeodomain-like / Zinc finger TFIIS-type signature. / HRDC-like superfamily / RNA polymerase Rpb7-like , N-terminal / RNA polymerase Rpb7-like, N-terminal domain superfamily / RNA polymerase subunit Rpb7-like / SHS2 domain found in N terminus of Rpb7p/Rpc25p/MJ0397 / RNA polymerase Rpb2, domain 5 / RNA polymerase Rpb2, domain 5 / RNA polymerase Rpb2, domain 4 / RNA polymerase Rpb2, domain 4 / DNA-directed RNA polymerase, M/15kDa subunit / RNA polymerases M/15 Kd subunit / RNA polymerase subunit 9 / DNA-directed RNA polymerase M, 15kDa subunit, conserved site / RNA polymerases M / 15 Kd subunits signature. / DNA-directed RNA polymerase subunit/transcription factor S / : / RNA polymerase, Rpb8 / DNA-directed RNA polymerases I, II, and III subunit RPABC4
Similarity search - Domain/homology
DNA / DNA (> 10) / RNA / RNA (> 10) / RNA polymerase II subunit D / DNA-directed RNA polymerase II subunit RPB11-a / DNA-directed RNA polymerases I, II, and III subunit RPABC2 / DNA-directed RNA polymerases I, II, and III subunit RPABC3 / DNA-directed RNA polymerase II subunit RPB3 / DNA-directed RNA polymerase subunit beta ...DNA / DNA (> 10) / RNA / RNA (> 10) / RNA polymerase II subunit D / DNA-directed RNA polymerase II subunit RPB11-a / DNA-directed RNA polymerases I, II, and III subunit RPABC2 / DNA-directed RNA polymerases I, II, and III subunit RPABC3 / DNA-directed RNA polymerase II subunit RPB3 / DNA-directed RNA polymerase subunit beta / DNA-directed RNA polymerase subunit / DNA-directed RNA polymerase II subunit RPB7 / RNA polymerase II, I and III subunit K / DNA-directed RNA polymerase II subunit E / Transcription elongation factor SPT5 / Negative elongation factor E / DNA-directed RNA polymerase II subunit RPB9 / Transcription elongation factor SPT4 / Negative elongation factor C/D / Negative elongation factor B / Negative elongation factor A
Similarity search - Component
Biological speciesHomo sapiens (human)
Sus scrofa (pig)
Human immunodeficiency virus 1
MethodELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 3.2 Å
AuthorsVos, S.M. / Farnung, L. / Urlaub, H. / Cramer, P.
Funding support Germany, 3items
OrganizationGrant numberCountry
European Molecular Biology OrganizationALTF-725-2014 Germany
German Research FoundationDFG SFB860 Germany
European Research Council693023 Germany
CitationJournal: Nature / Year: 2018
Title: Structure of paused transcription complex Pol II-DSIF-NELF.
Authors: Seychelle M Vos / Lucas Farnung / Henning Urlaub / Patrick Cramer /
Abstract: Metazoan gene regulation often involves the pausing of RNA polymerase II (Pol II) in the promoter-proximal region. Paused Pol II is stabilized by the protein complexes DRB sensitivity-inducing factor ...Metazoan gene regulation often involves the pausing of RNA polymerase II (Pol II) in the promoter-proximal region. Paused Pol II is stabilized by the protein complexes DRB sensitivity-inducing factor (DSIF) and negative elongation factor (NELF). Here we report the cryo-electron microscopy structure of a paused transcription elongation complex containing Sus scrofa Pol II and Homo sapiens DSIF and NELF at 3.2 Å resolution. The structure reveals a tilted DNA-RNA hybrid that impairs binding of the nucleoside triphosphate substrate. NELF binds the polymerase funnel, bridges two mobile polymerase modules, and contacts the trigger loop, thereby restraining Pol II mobility that is required for pause release. NELF prevents binding of the anti-pausing transcription elongation factor IIS (TFIIS). Additionally, NELF possesses two flexible 'tentacles' that can contact DSIF and exiting RNA. These results define the paused state of Pol II and provide the molecular basis for understanding the function of NELF during promoter-proximal gene regulation.
History
DepositionMay 27, 2018Deposition site: PDBE / Processing site: PDBE
Revision 1.0Sep 5, 2018Provider: repository / Type: Initial release
Revision 1.1Sep 12, 2018Group: Data collection / Database references / Category: citation
Item: _citation.journal_volume / _citation.page_first / _citation.page_last
Revision 1.2Oct 3, 2018Group: Data collection / Experimental preparation / Category: em_sample_support / Item: _em_sample_support.grid_type
Revision 2.0Jan 23, 2019Group: Advisory / Data collection ...Advisory / Data collection / Database references / Polymer sequence / Source and taxonomy / Structure summary
Category: em_entity_assembly / entity ...em_entity_assembly / entity / entity_name_com / entity_poly / entity_poly_seq / entity_src_gen / pdbx_poly_seq_scheme / pdbx_unobs_or_zero_occ_residues / struct_ref / struct_ref_seq / struct_ref_seq_dif
Item: _em_entity_assembly.entity_id_list / _entity.formula_weight ..._em_entity_assembly.entity_id_list / _entity.formula_weight / _entity.pdbx_description / _entity_poly.nstd_monomer / _entity_poly.pdbx_seq_one_letter_code / _entity_poly.pdbx_seq_one_letter_code_can
Revision 2.1Dec 11, 2019Group: Other / Category: atom_sites / cell
Item: _atom_sites.fract_transf_matrix[1][1] / _atom_sites.fract_transf_matrix[2][2] ..._atom_sites.fract_transf_matrix[1][1] / _atom_sites.fract_transf_matrix[2][2] / _atom_sites.fract_transf_matrix[3][3] / _cell.Z_PDB
Revision 2.2May 15, 2024Group: Data collection / Database references / Category: chem_comp_atom / chem_comp_bond / database_2
Item: _database_2.pdbx_DOI / _database_2.pdbx_database_accession

-
Structure visualization

Movie
  • Deposited structure unit
  • Imaged by Jmol
  • Download
Movie viewer
Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
A: DNA-directed RNA polymerase subunit
B: DNA-directed RNA polymerase subunit beta
C: RNA polymerase II subunit C
E: RNA polymerase II subunit E
F: RNA polymerase II subunit F
H: DNA-directed RNA polymerases I, II, and III subunit RPABC3
I: DNA-directed RNA polymerase II subunit RPB9
J: Uncharacterized protein
K: Uncharacterized protein
L: Uncharacterized protein
N: Non-template DNA
P: TAR RNA
T: Template DNA
U: Negative elongation factor A
V: Negative elongation factor B,Negative elongation factor B
W: Negative elongation factor C/D
X: Negative elongation factor E,Negative elongation factor E
Y: Transcription elongation factor SPT4
Z: Transcription elongation factor SPT5
D: RNA polymerase II subunit D
G: RNA polymerase II subunit G
hetero molecules


Theoretical massNumber of molelcules
Total (without water)928,51631
Polymers927,90321
Non-polymers61310
Water00
1


  • Idetical with deposited unit
  • defined by author
  • Evidence: gel filtration
TypeNameSymmetry operationNumber
identity operation1_5551

-
Components

-
DNA-directed RNA polymerase ... , 3 types, 3 molecules ABI

#1: Protein DNA-directed RNA polymerase subunit


Mass: 217450.078 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Sus scrofa (pig) / Organ: Thymus
References: UniProt: I3LJR4*PLUS, DNA-directed RNA polymerase
#2: Protein DNA-directed RNA polymerase subunit beta


Mass: 134041.422 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Sus scrofa (pig) / Organ: Thymus / References: UniProt: I3LGP4, DNA-directed RNA polymerase
#7: Protein DNA-directed RNA polymerase II subunit RPB9 / RNA polymerase II subunit B9 / DNA-directed RNA polymerase II subunit I / RNA polymerase II 14.5 ...RNA polymerase II subunit B9 / DNA-directed RNA polymerase II subunit I / RNA polymerase II 14.5 kDa subunit / RPB14.5


Mass: 14541.221 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Sus scrofa (pig) / Organ: Thymus / References: UniProt: P60899

-
RNA polymerase II subunit ... , 5 types, 5 molecules CEFDG

#3: Protein RNA polymerase II subunit C


Mass: 30997.557 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Sus scrofa (pig) / Organ: Thymus / References: UniProt: I3LCH3
#4: Protein RNA polymerase II subunit E


Mass: 24644.318 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Sus scrofa (pig) / Organ: Thymus / References: UniProt: I3LSI7
#5: Protein RNA polymerase II subunit F


Mass: 14477.001 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Sus scrofa (pig) / References: UniProt: F1SKN8
#20: Protein RNA polymerase II subunit D


Mass: 16331.255 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Sus scrofa (pig) / Organ: Thymus / References: UniProt: A0A287ADR4
#21: Protein RNA polymerase II subunit G


Mass: 19314.283 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Sus scrofa (pig) / Organ: Thymus / References: UniProt: I3LJZ9

-
Uncharacterized ... , 3 types, 3 molecules JKL

#8: Protein Uncharacterized protein


Mass: 7655.123 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Sus scrofa (pig) / Organ: Thymus
#9: Protein Uncharacterized protein


Mass: 13310.284 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Sus scrofa (pig) / Organ: Thymus / References: UniProt: F1RKE4
#10: Protein Uncharacterized protein


Mass: 7018.244 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Sus scrofa (pig) / Organ: Thymus / References: UniProt: I3LN51

-
DNA chain , 2 types, 2 molecules NT

#11: DNA chain Non-template DNA


Mass: 14712.466 Da / Num. of mol.: 1
Mutation: bases 1-23 mutated, original sequence: CTCTGGCTATCTAGGGAACCCTC
Source method: obtained synthetically
Details: mutated from original sequence for structural work
Source: (synth.) Human immunodeficiency virus 1
#13: DNA chain Template DNA


Mass: 14910.556 Da / Num. of mol.: 1
Mutation: Bases 35-48 were mutated from ATAGATAGCCAGAG to AGGTACTAGTGTAC
Source method: obtained synthetically / Source: (synth.) Human immunodeficiency virus 1

-
Negative elongation factor ... , 4 types, 4 molecules UVWX

#14: Protein Negative elongation factor A / NELF-A / Wolf-Hirschhorn syndrome candidate 2 protein


Mass: 57343.598 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: NELFA, WHSC2, P/OKcl.15 / Production host: Trichoplusia ni (cabbage looper) / References: UniProt: Q9H3P2
#15: Protein Negative elongation factor B,Negative elongation factor B / NELF-B / Cofactor of BRCA1


Mass: 64577.230 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: NELFB, COBRA1, KIAA1182 / Production host: Trichoplusia ni (cabbage looper) / References: UniProt: Q8WX92
#16: Protein Negative elongation factor C/D / NELF-C/D / TH1-like protein


Mass: 64651.746 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: NELFCD, NELFD, TH1, TH1L, HSPC130 / Production host: Trichoplusia ni (cabbage looper) / References: UniProt: Q8IXH7
#17: Protein Negative elongation factor E,Negative elongation factor E / NELF-E / RNA-binding protein RD


Mass: 45363.449 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: NELFE, RD, RDBP / Production host: Trichoplusia ni (cabbage looper) / References: UniProt: P18615

-
Transcription elongation factor ... , 2 types, 2 molecules YZ

#18: Protein Transcription elongation factor SPT4 / hSPT4 / DRB sensitivity-inducing factor 14 kDa subunit / DSIF p14 / DRB sensitivity-inducing factor ...hSPT4 / DRB sensitivity-inducing factor 14 kDa subunit / DSIF p14 / DRB sensitivity-inducing factor small subunit / DSIF small subunit


Mass: 13508.496 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: SUPT4H1, SPT4H, SUPT4H / Production host: Escherichia coli BL21(DE3) (bacteria) / Variant (production host): RIL / References: UniProt: P63272
#19: Protein Transcription elongation factor SPT5 / hSPT5 / DRB sensitivity-inducing factor 160 kDa subunit / DSIF p160 / DRB sensitivity-inducing ...hSPT5 / DRB sensitivity-inducing factor 160 kDa subunit / DSIF p160 / DRB sensitivity-inducing factor large subunit / DSIF large subunit / Tat-cotransactivator 1 protein / Tat-CT1 protein


Mass: 121145.477 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: SUPT5H, SPT5, SPT5H / Production host: Escherichia coli BL21(DE3) (bacteria) / Variant (production host): RIL / References: UniProt: O00267

-
Protein / RNA chain , 2 types, 2 molecules HP

#12: RNA chain TAR RNA


Mass: 14746.812 Da / Num. of mol.: 1 / Source method: obtained synthetically / Source: (synth.) Human immunodeficiency virus 1
#6: Protein DNA-directed RNA polymerases I, II, and III subunit RPABC3


Mass: 17162.273 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Sus scrofa (pig) / Organ: Thymus / References: UniProt: I3LCB2

-
Non-polymers , 2 types, 10 molecules

#22: Chemical ChemComp-MG / MAGNESIUM ION


Mass: 24.305 Da / Num. of mol.: 1 / Source method: obtained synthetically / Formula: Mg
#23: Chemical
ChemComp-ZN / ZINC ION


Mass: 65.409 Da / Num. of mol.: 9 / Source method: obtained synthetically / Formula: Zn

-
Experimental details

-
Experiment

ExperimentMethod: ELECTRON MICROSCOPY
EM experimentAggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction

-
Sample preparation

Component
IDNameTypeEntity IDParent-IDSource
1RNA Polymerase II elongation complex bound to DSIF and NELFCOMPLEX#2-#17, #19-#210MULTIPLE SOURCES
2Sus scrofa RNA Polymerase IICOMPLEX#2-#10, #20-#211NATURAL
3Negative elongation factor (NELF)COMPLEX#14-#171RECOMBINANT
4DRB sensitivity inducing factor (DSIF)COMPLEX#191RECOMBINANT
5HIV-1 pause transcription scaffoldCOMPLEX#11-#131RECOMBINANT
Molecular weightValue: .9271 MDa / Experimental value: NO
Source (natural)
IDEntity assembly-IDOrganismNcbi tax-ID
12Sus scrofa (pig)9823
23Homo sapiens (human)9606
35Human immunodeficiency virus 111676
44Human immunodeficiency virus 111676
Source (recombinant)
IDEntity assembly-IDOrganismNcbi tax-ID
13Trichoplusia ni (cabbage looper)7111
25synthetic construct (others)32630
34Escherichia coli BL21(DE3) (bacteria)469008
Buffer solutionpH: 7.4
SpecimenConc.: 0.2 mg/ml / Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES
Specimen supportGrid material: GOLD / Grid type: Quantifoil UltrAuFoil
VitrificationInstrument: FEI VITROBOT MARK IV / Cryogen name: ETHANE / Humidity: 100 % / Chamber temperature: 277 K

-
Electron microscopy imaging

Experimental equipment
Model: Titan Krios / Image courtesy: FEI Company
MicroscopyModel: FEI TITAN KRIOS
Electron gunElectron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: SPOT SCAN
Electron lensMode: BRIGHT FIELD / Nominal magnification: 165000 X / Alignment procedure: COMA FREE
Specimen holderCryogen: NITROGEN / Specimen holder model: FEI TITAN KRIOS AUTOGRID HOLDER
Image recordingAverage exposure time: 9 sec. / Electron dose: 46 e/Å2 / Detector mode: COUNTING / Film or detector model: GATAN K2 QUANTUM (4k x 4k) / Num. of real images: 11740
EM imaging opticsEnergyfilter name: GIF Quantum LS / Energyfilter slit width: 20 eV
Image scansMovie frames/image: 36

-
Processing

SoftwareName: PHENIX / Version: 1.13_2998: / Classification: refinement
EM software
IDNameVersionCategory
2EPUimage acquisition
13RELION2.13D reconstruction
CTF correctionType: PHASE FLIPPING AND AMPLITUDE CORRECTION
SymmetryPoint symmetry: C1 (asymmetric)
3D reconstructionResolution: 3.2 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 162269 / Symmetry type: POINT

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242)：Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more