+
Open data
-
Basic information
| Entry | Database: PDB / ID: 6gml | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Title | Structure of paused transcription complex Pol II-DSIF-NELF | ||||||||||||
Components |
| ||||||||||||
Keywords | TRANSCRIPTION / RNA polymerase II / pausing / NELF / DSIF | ||||||||||||
| Function / homology | Function and homology informationNELF complex / NTRK3 as a dependence receptor / negative regulation of DNA-templated transcription, elongation / : / transcription pausing by RNA polymerase II / negative regulation of stem cell differentiation / DSIF complex / regulation of transcription elongation by RNA polymerase II / B-WICH complex positively regulates rRNA expression / RNA Polymerase I Transcription Initiation ...NELF complex / NTRK3 as a dependence receptor / negative regulation of DNA-templated transcription, elongation / : / transcription pausing by RNA polymerase II / negative regulation of stem cell differentiation / DSIF complex / regulation of transcription elongation by RNA polymerase II / B-WICH complex positively regulates rRNA expression / RNA Polymerase I Transcription Initiation / RNA Polymerase I Promoter Escape / RNA Polymerase I Transcription Termination / RNA Polymerase III Transcription Initiation From Type 1 Promoter / RNA Polymerase III Transcription Initiation From Type 2 Promoter / RNA Polymerase III Transcription Initiation From Type 3 Promoter / Formation of RNA Pol II elongation complex / Formation of the Early Elongation Complex / Transcriptional regulation by small RNAs / RNA Polymerase II Pre-transcription Events / TP53 Regulates Transcription of DNA Repair Genes / FGFR2 alternative splicing / RNA polymerase II transcribes snRNA genes / mRNA Capping / mRNA Splicing - Minor Pathway / Processing of Capped Intron-Containing Pre-mRNA / RNA Polymerase II Promoter Escape / RNA Polymerase II Transcription Pre-Initiation And Promoter Opening / RNA Polymerase II Transcription Initiation / RNA Polymerase II Transcription Elongation / RNA Polymerase II Transcription Initiation And Promoter Clearance / RNA Pol II CTD phosphorylation and interaction with CE / Estrogen-dependent gene expression / mRNA Splicing - Major Pathway / mRNA Polyadenylation / Formation of TC-NER Pre-Incision Complex / Dual incision in TC-NER / Gap-filling DNA repair synthesis and ligation in TC-NER / positive regulation of DNA-templated transcription, elongation / Abortive elongation of HIV-1 transcript in the absence of Tat / transcription elongation-coupled chromatin remodeling / negative regulation of transcription elongation by RNA polymerase II / RNA Pol II CTD phosphorylation and interaction with CE during HIV infection / RNA Pol II CTD phosphorylation and interaction with CE / Formation of the Early Elongation Complex / Formation of the HIV-1 Early Elongation Complex / mRNA Capping / organelle membrane / positive regulation of nuclear-transcribed mRNA poly(A) tail shortening / positive regulation of macroautophagy / RNA polymerase II complex binding / termination of RNA polymerase II transcription / RNA polymerase II transcribes snRNA genes / Pausing and recovery of Tat-mediated HIV elongation / Tat-mediated HIV elongation arrest and recovery / HIV elongation arrest and recovery / Pausing and recovery of HIV elongation / maintenance of transcriptional fidelity during transcription elongation by RNA polymerase II / positive regulation of translational initiation / Tat-mediated elongation of the HIV-1 transcript / Formation of HIV-1 elongation complex containing HIV-1 Tat / core promoter sequence-specific DNA binding / Formation of HIV elongation complex in the absence of HIV Tat / termination of RNA polymerase III transcription / transcription initiation at RNA polymerase III promoter / RNA Polymerase II Transcription Elongation / RNA polymerase I complex / RNA polymerase III complex / Formation of RNA Pol II elongation complex / RNA polymerase II, core complex / stem cell differentiation / transcription elongation by RNA polymerase I / tRNA transcription by RNA polymerase III / transcription by RNA polymerase I / RNA Polymerase II Pre-transcription Events / transcription-coupled nucleotide-excision repair / translation initiation factor binding / DNA-templated transcription elongation / TP53 Regulates Transcription of DNA Repair Genes / positive regulation of transcription elongation by RNA polymerase II / P-body / transcription initiation at RNA polymerase II promoter / euchromatin / transcription elongation by RNA polymerase II / mRNA transcription by RNA polymerase II / fibrillar center / transcription by RNA polymerase II / cell population proliferation / ribonucleoside binding / DNA-directed RNA polymerase / DNA-directed RNA polymerase activity / single-stranded DNA binding / molecular adaptor activity / nuclear body / nucleic acid binding / positive regulation of ERK1 and ERK2 cascade / chromosome, telomeric region / nuclear speck / protein dimerization activity / single-stranded RNA binding / chromosome Similarity search - Function | ||||||||||||
| Biological species | Homo sapiens (human)![]() ![]() Human immunodeficiency virus 1 | ||||||||||||
| Method | ELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 3.2 Å | ||||||||||||
Authors | Vos, S.M. / Farnung, L. / Urlaub, H. / Cramer, P. | ||||||||||||
| Funding support | Germany, 3items
| ||||||||||||
Citation | Journal: Nature / Year: 2018Title: Structure of paused transcription complex Pol II-DSIF-NELF. Authors: Seychelle M Vos / Lucas Farnung / Henning Urlaub / Patrick Cramer / ![]() Abstract: Metazoan gene regulation often involves the pausing of RNA polymerase II (Pol II) in the promoter-proximal region. Paused Pol II is stabilized by the protein complexes DRB sensitivity-inducing factor ...Metazoan gene regulation often involves the pausing of RNA polymerase II (Pol II) in the promoter-proximal region. Paused Pol II is stabilized by the protein complexes DRB sensitivity-inducing factor (DSIF) and negative elongation factor (NELF). Here we report the cryo-electron microscopy structure of a paused transcription elongation complex containing Sus scrofa Pol II and Homo sapiens DSIF and NELF at 3.2 Å resolution. The structure reveals a tilted DNA-RNA hybrid that impairs binding of the nucleoside triphosphate substrate. NELF binds the polymerase funnel, bridges two mobile polymerase modules, and contacts the trigger loop, thereby restraining Pol II mobility that is required for pause release. NELF prevents binding of the anti-pausing transcription elongation factor IIS (TFIIS). Additionally, NELF possesses two flexible 'tentacles' that can contact DSIF and exiting RNA. These results define the paused state of Pol II and provide the molecular basis for understanding the function of NELF during promoter-proximal gene regulation. | ||||||||||||
| History |
|
-
Structure visualization
| Movie |
Movie viewer |
|---|---|
| Structure viewer | Molecule: Molmil Jmol/JSmol |
-
Downloads & links
-
Download
| PDBx/mmCIF format | 6gml.cif.gz | 1 MB | Display | PDBx/mmCIF format |
|---|---|---|---|---|
| PDB format | pdb6gml.ent.gz | 821.7 KB | Display | PDB format |
| PDBx/mmJSON format | 6gml.json.gz | Tree view | PDBx/mmJSON format | |
| Others | Other downloads |
-Validation report
| Arichive directory | https://data.pdbj.org/pub/pdb/validation_reports/gm/6gml ftp://data.pdbj.org/pub/pdb/validation_reports/gm/6gml | HTTPS FTP |
|---|
-Related structure data
| Related structure data | ![]() 0038MC ![]() 0039C ![]() 0040C ![]() 0041C ![]() 0042C M: map data used to model this data C: citing same article ( |
|---|---|
| Similar structure data |
-
Links
-
Assembly
| Deposited unit | ![]()
|
|---|---|
| 1 |
|
-
Components
-DNA-directed RNA polymerase ... , 3 types, 3 molecules ABI
| #1: Protein | Mass: 217450.078 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) ![]() References: UniProt: I3LJR4*PLUS, DNA-directed RNA polymerase |
|---|---|
| #2: Protein | Mass: 134041.422 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) ![]() |
| #7: Protein | Mass: 14541.221 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) ![]() |
-RNA polymerase II subunit ... , 5 types, 5 molecules CEFDG
| #3: Protein | Mass: 30997.557 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) ![]() |
|---|---|
| #4: Protein | Mass: 24644.318 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) ![]() |
| #5: Protein | Mass: 14477.001 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) ![]() |
| #20: Protein | Mass: 16331.255 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) ![]() |
| #21: Protein | Mass: 19314.283 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) ![]() |
-Uncharacterized ... , 3 types, 3 molecules JKL
| #8: Protein | Mass: 7655.123 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) ![]() |
|---|---|
| #9: Protein | Mass: 13310.284 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) ![]() |
| #10: Protein | Mass: 7018.244 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) ![]() |
-DNA chain , 2 types, 2 molecules NT
| #11: DNA chain | Mass: 14712.466 Da / Num. of mol.: 1 Mutation: bases 1-23 mutated, original sequence: CTCTGGCTATCTAGGGAACCCTC Source method: obtained synthetically Details: mutated from original sequence for structural work Source: (synth.) ![]() Human immunodeficiency virus 1 |
|---|---|
| #13: DNA chain | Mass: 14910.556 Da / Num. of mol.: 1 Mutation: Bases 35-48 were mutated from ATAGATAGCCAGAG to AGGTACTAGTGTAC Source method: obtained synthetically / Source: (synth.) ![]() Human immunodeficiency virus 1 |
-Negative elongation factor ... , 4 types, 4 molecules UVWX
| #14: Protein | Mass: 57343.598 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Homo sapiens (human) / Gene: NELFA, WHSC2, P/OKcl.15 / Production host: Trichoplusia ni (cabbage looper) / References: UniProt: Q9H3P2 |
|---|---|
| #15: Protein | Mass: 64577.230 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Homo sapiens (human) / Gene: NELFB, COBRA1, KIAA1182 / Production host: Trichoplusia ni (cabbage looper) / References: UniProt: Q8WX92 |
| #16: Protein | Mass: 64651.746 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Homo sapiens (human) / Gene: NELFCD, NELFD, TH1, TH1L, HSPC130 / Production host: Trichoplusia ni (cabbage looper) / References: UniProt: Q8IXH7 |
| #17: Protein | Mass: 45363.449 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Homo sapiens (human) / Gene: NELFE, RD, RDBP / Production host: Trichoplusia ni (cabbage looper) / References: UniProt: P18615 |
-Transcription elongation factor ... , 2 types, 2 molecules YZ
| #18: Protein | Mass: 13508.496 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Homo sapiens (human) / Gene: SUPT4H1, SPT4H, SUPT4H / Production host: ![]() |
|---|---|
| #19: Protein | Mass: 121145.477 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Homo sapiens (human) / Gene: SUPT5H, SPT5, SPT5H / Production host: ![]() |
-Protein / RNA chain , 2 types, 2 molecules HP
| #12: RNA chain | Mass: 14746.812 Da / Num. of mol.: 1 / Source method: obtained synthetically / Source: (synth.) ![]() Human immunodeficiency virus 1 |
|---|---|
| #6: Protein | Mass: 17162.273 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) ![]() |
-Non-polymers , 2 types, 10 molecules 


| #22: Chemical | ChemComp-MG / |
|---|---|
| #23: Chemical | ChemComp-ZN / |
-Experimental details
-Experiment
| Experiment | Method: ELECTRON MICROSCOPY |
|---|---|
| EM experiment | Aggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction |
-
Sample preparation
| Component |
| ||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Molecular weight | Value: .9271 MDa / Experimental value: NO | ||||||||||||||||||||||||||||||||||||
| Source (natural) |
| ||||||||||||||||||||||||||||||||||||
| Source (recombinant) |
| ||||||||||||||||||||||||||||||||||||
| Buffer solution | pH: 7.4 | ||||||||||||||||||||||||||||||||||||
| Specimen | Conc.: 0.2 mg/ml / Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES | ||||||||||||||||||||||||||||||||||||
| Specimen support | Grid material: GOLD / Grid type: Quantifoil UltrAuFoil | ||||||||||||||||||||||||||||||||||||
| Vitrification | Instrument: FEI VITROBOT MARK IV / Cryogen name: ETHANE / Humidity: 100 % / Chamber temperature: 277 K |
-
Electron microscopy imaging
| Experimental equipment | ![]() Model: Titan Krios / Image courtesy: FEI Company |
|---|---|
| Microscopy | Model: FEI TITAN KRIOS |
| Electron gun | Electron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: SPOT SCAN |
| Electron lens | Mode: BRIGHT FIELD / Nominal magnification: 165000 X / Alignment procedure: COMA FREE |
| Specimen holder | Cryogen: NITROGEN / Specimen holder model: FEI TITAN KRIOS AUTOGRID HOLDER |
| Image recording | Average exposure time: 9 sec. / Electron dose: 46 e/Å2 / Detector mode: COUNTING / Film or detector model: GATAN K2 QUANTUM (4k x 4k) / Num. of real images: 11740 |
| EM imaging optics | Energyfilter name: GIF Quantum LS / Energyfilter slit width: 20 eV |
| Image scans | Movie frames/image: 36 |
-
Processing
| Software | Name: PHENIX / Version: 1.13_2998: / Classification: refinement | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| EM software |
| ||||||||||||
| CTF correction | Type: PHASE FLIPPING AND AMPLITUDE CORRECTION | ||||||||||||
| Symmetry | Point symmetry: C1 (asymmetric) | ||||||||||||
| 3D reconstruction | Resolution: 3.2 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 162269 / Symmetry type: POINT |
Movie
Controller
About Yorodumi




Homo sapiens (human)

Human immunodeficiency virus 1
Germany, 3items
Citation












PDBj




































































gel filtration
Trichoplusia ni (cabbage looper)

