[English] 日本語
Yorodumi
- PDB-5c51: Probing the Structural and Molecular Basis of Nucleotide Selectiv... -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 5c51
TitleProbing the Structural and Molecular Basis of Nucleotide Selectivity by Human Mitochondrial DNA Polymerase gamma
Components
  • (DNA polymerase subunit gamma- ...) x 2
  • DNA
  • DNA (5'-D(*(AD)P*AP*AP*AP*CP*GP*AP*GP*GP*GP*CP*CP*AP*GP*TP*GP*CP*CP*GP*TP*AP*C)-3')
Keywordstransferase/dna / Nucleoside reverse transcriptase inhibitors (NRTIs) / HIV RT / human mitochondrial DNA polymerase / mitochondrial toxicity / drug efficacy and toxicity / transferase-dna complex
Function / homology
Function and homology information


gamma DNA polymerase complex / positive regulation of DNA-directed DNA polymerase activity / mitochondrial chromosome / Strand-asynchronous mitochondrial DNA replication / mitochondrial DNA replication / DNA replication proofreading / single-stranded DNA 3'-5' DNA exonuclease activity / Hydrolases; Acting on ester bonds; Exodeoxyribonucleases producing 5'-phosphomonoesters / DNA metabolic process / DNA polymerase processivity factor activity ...gamma DNA polymerase complex / positive regulation of DNA-directed DNA polymerase activity / mitochondrial chromosome / Strand-asynchronous mitochondrial DNA replication / mitochondrial DNA replication / DNA replication proofreading / single-stranded DNA 3'-5' DNA exonuclease activity / Hydrolases; Acting on ester bonds; Exodeoxyribonucleases producing 5'-phosphomonoesters / DNA metabolic process / DNA polymerase processivity factor activity / Lyases; Carbon-oxygen lyases; Other carbon-oxygen lyases / mitochondrial nucleoid / 5'-deoxyribose-5-phosphate lyase activity / base-excision repair, gap-filling / DNA polymerase binding / 3'-5' exonuclease activity / mitochondrion organization / Transcriptional activation of mitochondrial biogenesis / base-excision repair / DNA-templated DNA replication / in utero embryonic development / protease binding / double-stranded DNA binding / DNA-directed DNA polymerase / DNA-directed DNA polymerase activity / mitochondrial matrix / chromatin binding / protein-containing complex / mitochondrion / DNA binding / identical protein binding / cytoplasm
Similarity search - Function
DNA-directed DNA-polymerase, family A, mitochondria / DNA mitochondrial polymerase, exonuclease domain / POLG2, C-terminal / : / DNA mitochondrial polymerase exonuclease domain / Glycyl-tRNA synthetase/DNA polymerase subunit gamma-2 / Anticodon-binding domain / Anticodon-binding / Anticodon binding domain / DNA polymerase family A ...DNA-directed DNA-polymerase, family A, mitochondria / DNA mitochondrial polymerase, exonuclease domain / POLG2, C-terminal / : / DNA mitochondrial polymerase exonuclease domain / Glycyl-tRNA synthetase/DNA polymerase subunit gamma-2 / Anticodon-binding domain / Anticodon-binding / Anticodon binding domain / DNA polymerase family A / Anticodon-binding domain superfamily / DNA-directed DNA polymerase, family A, conserved site / DNA polymerase family A signature. / DNA-directed DNA polymerase, family A, palm domain / DNA polymerase A domain / Bira Bifunctional Protein; Domain 2 / BirA Bifunctional Protein; domain 2 / Class II Aminoacyl-tRNA synthetase/Biotinyl protein ligase (BPL) and lipoyl protein ligase (LPL) / Ribonuclease H-like superfamily / DNA/RNA polymerase superfamily / Rossmann fold / 2-Layer Sandwich / 3-Layer(aba) Sandwich / Alpha Beta
Similarity search - Domain/homology
Chem-1RY / DNA / DNA (> 10) / DNA polymerase subunit gamma-1 / DNA polymerase subunit gamma-2
Similarity search - Component
Biological speciesHomo sapiens (human)
Virus Chimp162
DNA launch vector pDE-GFP2 (others)
MethodX-RAY DIFFRACTION / SYNCHROTRON / Resolution: 3.426 Å
AuthorsSohl, C.D. / Szymanski, M.R. / Mislak, A.C. / Shumate, C.K. / Amiralaei, S. / Schinazi, R.F. / Anderson, K.S. / Whitney, Y.Y.
CitationJournal: Proc.Natl.Acad.Sci.USA / Year: 2015
Title: Probing the structural and molecular basis of nucleotide selectivity by human mitochondrial DNA polymerase gamma.
Authors: Sohl, C.D. / Szymanski, M.R. / Mislak, A.C. / Shumate, C.K. / Amiralaei, S. / Schinazi, R.F. / Anderson, K.S. / Yin, Y.W.
History
DepositionJun 19, 2015Deposition site: RCSB / Processing site: RCSB
Revision 1.0May 11, 2016Provider: repository / Type: Initial release
Revision 1.1May 18, 2016Group: Other
Revision 1.2Dec 25, 2024Group: Advisory / Data collection ...Advisory / Data collection / Database references / Derived calculations / Structure summary
Category: chem_comp_atom / chem_comp_bond ...chem_comp_atom / chem_comp_bond / database_2 / ndb_struct_na_base_pair / pdbx_entry_details / pdbx_struct_oper_list / pdbx_validate_close_contact / struct_conn
Item: _database_2.pdbx_DOI / _database_2.pdbx_database_accession ..._database_2.pdbx_DOI / _database_2.pdbx_database_accession / _pdbx_struct_oper_list.symmetry_operation / _struct_conn.conn_type_id / _struct_conn.details / _struct_conn.id / _struct_conn.pdbx_dist_value / _struct_conn.pdbx_leaving_atom_flag / _struct_conn.ptnr1_auth_asym_id / _struct_conn.ptnr1_auth_comp_id / _struct_conn.ptnr1_auth_seq_id / _struct_conn.ptnr1_label_asym_id / _struct_conn.ptnr1_label_atom_id / _struct_conn.ptnr1_label_comp_id / _struct_conn.ptnr1_label_seq_id / _struct_conn.ptnr2_auth_asym_id / _struct_conn.ptnr2_auth_comp_id / _struct_conn.ptnr2_auth_seq_id / _struct_conn.ptnr2_label_asym_id / _struct_conn.ptnr2_label_atom_id / _struct_conn.ptnr2_label_comp_id / _struct_conn.ptnr2_label_seq_id

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
A: DNA polymerase subunit gamma-1
B: DNA polymerase subunit gamma-2, mitochondrial
C: DNA polymerase subunit gamma-2, mitochondrial
P: DNA (5'-D(*(AD)P*AP*AP*AP*CP*GP*AP*GP*GP*GP*CP*CP*AP*GP*TP*GP*CP*CP*GP*TP*AP*C)-3')
T: DNA
hetero molecules


Theoretical massNumber of molelcules
Total (without water)261,0048
Polymers260,4685
Non-polymers5363
Water00
1


  • Idetical with deposited unit
  • defined by author&software
TypeNameSymmetry operationNumber
identity operation1_555x,y,z1
Buried area16790 Å2
ΔGint-77 kcal/mol
Surface area84890 Å2
MethodPISA
Unit cell
Length a, b, c (Å)215.049, 215.049, 161.692
Angle α, β, γ (deg.)90.00, 90.00, 90.00
Int Tables number92
Space group name H-MP41212

-
Components

-
DNA polymerase subunit gamma- ... , 2 types, 3 molecules ABC

#1: Protein DNA polymerase subunit gamma-1 / Mitochondrial DNA polymerase catalytic subunit / PolG-alpha


Mass: 136033.531 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: POLG, MDP1, POLG1, POLGA / Cell line (production host): sf9
Production host: Insect cell expression vector pTIE1 (others)
References: UniProt: P54098, DNA-directed DNA polymerase
#2: Protein DNA polymerase subunit gamma-2, mitochondrial / DNA polymerase gamma accessory 55 kDa subunit / p55 / Mitochondrial DNA polymerase accessory ...DNA polymerase gamma accessory 55 kDa subunit / p55 / Mitochondrial DNA polymerase accessory subunit / MtPolB / PolG-beta


Mass: 54991.000 Da / Num. of mol.: 2
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: POLG2, MTPOLB
Production host: Insect cell expression vector pTIE1 (others)
References: UniProt: Q9UHN1, DNA-directed DNA polymerase

-
DNA chain , 2 types, 2 molecules PT

#3: DNA chain DNA (5'-D(*(AD)P*AP*AP*AP*CP*GP*AP*GP*GP*GP*CP*CP*AP*GP*TP*GP*CP*CP*GP*TP*AP*C)-3')


Mass: 6779.408 Da / Num. of mol.: 1 / Source method: obtained synthetically / Details: AAAACGAGGGCCAGTGCCGTAC / Source: (synth.) Virus Chimp162
#4: DNA chain DNA


Mass: 7672.917 Da / Num. of mol.: 1 / Source method: obtained synthetically / Source: (synth.) DNA launch vector pDE-GFP2 (others)

-
Non-polymers , 2 types, 3 molecules

#5: Chemical ChemComp-MG / MAGNESIUM ION


Mass: 24.305 Da / Num. of mol.: 2 / Source method: obtained synthetically / Formula: Mg
#6: Chemical ChemComp-1RY / [[(2R,5S)-5-(4-azanyl-5-fluoranyl-2-oxidanylidene-pyrimidin-1-yl)-1,3-oxathiolan-2-yl]methoxy-oxidanyl-phosphoryl] phosphono hydrogen phosphate


Mass: 487.186 Da / Num. of mol.: 1 / Source method: obtained synthetically / Formula: C8H13FN3O12P3S

-
Details

Has protein modificationN

-
Experimental details

-
Experiment

ExperimentMethod: X-RAY DIFFRACTION

-
Sample preparation

CrystalDensity Matthews: 3.68 Å3/Da / Density % sol: 66.62 %
Crystal growTemperature: 300 K / Method: vapor diffusion, sitting drop / pH: 6.5 / Details: PEG4000, KCl, HEPES

-
Data collection

DiffractionMean temperature: 100 K
Diffraction sourceSource: SYNCHROTRON / Site: ALS / Beamline: 8.2.1 / Wavelength: 1 Å
DetectorType: ADSC QUANTUM 315r / Detector: CCD / Date: Aug 1, 2014
RadiationProtocol: SINGLE WAVELENGTH / Monochromatic (M) / Laue (L): M / Scattering type: x-ray
Radiation wavelengthWavelength: 1 Å / Relative weight: 1
ReflectionResolution: 3.42→50 Å / Num. obs: 50770 / % possible obs: 95 % / Redundancy: 8 % / Net I/σ(I): 2

-
Processing

Software
NameVersionClassification
PHENIX1.9_1692refinement
HKL-2000data reduction
HKL-3000data scaling
PHASERphasing
RefinementResolution: 3.426→47.017 Å / SU ML: 0.66 / Cross valid method: FREE R-VALUE / σ(F): 1.33 / Phase error: 43.46 / Stereochemistry target values: ML
RfactorNum. reflection% reflection
Rfree0.3449 1990 3.94 %
Rwork0.3149 --
obs0.3161 50478 98.22 %
Solvent computationShrinkage radii: 0.9 Å / VDW probe radii: 1.11 Å / Solvent model: FLAT BULK SOLVENT MODEL
Refinement stepCycle: LAST / Resolution: 3.426→47.017 Å
ProteinNucleic acidLigandSolventTotal
Num. atoms13634 957 30 0 14621
Refine LS restraints
Refine-IDTypeDev idealNumber
X-RAY DIFFRACTIONf_bond_d0.00315078
X-RAY DIFFRACTIONf_angle_d0.75520629
X-RAY DIFFRACTIONf_dihedral_angle_d14.8695658
X-RAY DIFFRACTIONf_chiral_restr0.0282222
X-RAY DIFFRACTIONf_plane_restr0.0042473
LS refinement shell
Resolution (Å)Rfactor RfreeNum. reflection RfreeRfactor RworkNum. reflection RworkRefine-ID% reflection obs (%)
3.426-3.51170.47291190.47662879X-RAY DIFFRACTION83
3.5117-3.60660.50751420.43413450X-RAY DIFFRACTION100
3.6066-3.71270.46181440.42793490X-RAY DIFFRACTION100
3.7127-3.83250.48411410.43953452X-RAY DIFFRACTION100
3.8325-3.96940.44861430.3863469X-RAY DIFFRACTION99
3.9694-4.12820.39721420.37233458X-RAY DIFFRACTION100
4.1282-4.3160.39131410.36213478X-RAY DIFFRACTION99
4.316-4.54340.37251430.35183472X-RAY DIFFRACTION99
4.5434-4.82770.38121400.33483482X-RAY DIFFRACTION99
4.8277-5.20010.33581440.32583495X-RAY DIFFRACTION99
5.2001-5.72250.37171450.32573536X-RAY DIFFRACTION100
5.7225-6.54870.34181450.33533549X-RAY DIFFRACTION100
6.5487-8.24340.31421480.30673606X-RAY DIFFRACTION100
8.2434-47.02170.28151530.23653672X-RAY DIFFRACTION97
Refinement TLS params.

Method: refined / Refine-ID: X-RAY DIFFRACTION

IDL112)L122)L132)L222)L232)L332)S11 (Å °)S12 (Å °)S13 (Å °)S21 (Å °)S22 (Å °)S23 (Å °)S31 (Å °)S32 (Å °)S33 (Å °)T112)T122)T132)T222)T232)T332)Origin x (Å)Origin y (Å)Origin z (Å)
11.102-0.08390.18310.8926-0.79623.09740.0653-0.1935-0.1652-0.1288-0.1695-0.35760.40470.3390.01561.33610.007-0.02281.10070.13831.599363.9798-35.592624.5051
2-1.2034-1.0778-1.61453.62030.96781.47070.25520.0378-0.4105-0.3677-0.17280.39490.00330.01910.03731.0179-0.1565-0.11551.19070.19341.609245.9603-1.295927.7705
31.8007-0.5631.17610.865-0.1068-0.53650.28860.54330.1835-0.4874-0.09750.18720.25670.00690.01431.607-0.0958-0.04181.24860.18690.97953.3172-28.07650.8368
48.494-0.6086-0.02824.96110.12220.3817-0.5115-0.91360.65620.19340.4807-0.8537-0.29410.6229-0.1621.45140.07920.2581.08960.13340.45868.469228.221730.0144
54.37541.0847-1.23382.76570.67823.12010.4110.47-0.8822-0.6642-0.3419-0.09620.26660.04210.12681.34030.03080.19091.19680.09371.108468.217321.100319.8683
67.26490.00294.47075.9729-3.00314.2524-0.7776-0.02330.90381.11472.2152-2.8945-0.96071.99990.48051.45520.64020.57962.120.16062.154392.664420.768420.4487
72.54680.4143-4.04512.2710.16286.54730.0184-0.2195-0.2686-0.1726-0.2356-1.2804-0.2590.34860.29060.98430.12520.08281.043-0.01551.182871.305819.527223.5905
84.64143.84540.80776.1554-2.81633.8229-0.07621.64761.47230.0622-0.07010.117-0.5827-1.770.3421.40970.16430.331.44760.17731.561641.993123.894939.2003
93.25022.9380.346.8202-1.18698.6627-0.1080.1333-0.07481.0243-0.15110.7541-1.022-0.90490.27691.39370.07360.21631.29330.2171.544644.706821.420849.1116
104.1231-3.77322.57025.0159-3.69534.8250.83910.1569-0.1993-0.4285-1.36161.11760.1955-0.10330.03881.326-0.2408-0.16691.1883-0.0841.730377.827933.477842.118
116.9109-3.22512.24679.20892.02812.7528-0.58060.18151.31550.51580.2005-0.77-0.57740.19530.31661.7048-0.0227-0.13521.05750.2381.303668.094744.31849.9472
123.2425-1.4022-0.81394.32472.08782.56470.0840.16320.4197-0.36140.226-0.6426-0.24810.3787-0.58451.42370.0056-0.25371.24170.28591.163781.94677.437550.1192
Refinement TLS group
IDRefine-IDRefine TLS-IDSelection details
1X-RAY DIFFRACTION1chain 'A' and (resid 78 through 417 )
2X-RAY DIFFRACTION2chain 'A' and (resid 418 through 894 )
3X-RAY DIFFRACTION3chain 'A' and (resid 895 through 1228 )
4X-RAY DIFFRACTION4chain 'B' and (resid 68 through 205 )
5X-RAY DIFFRACTION5chain 'B' and (resid 206 through 306 )
6X-RAY DIFFRACTION6chain 'B' and (resid 307 through 325 )
7X-RAY DIFFRACTION7chain 'B' and (resid 326 through 352 )
8X-RAY DIFFRACTION8chain 'B' and (resid 353 through 395 )
9X-RAY DIFFRACTION9chain 'B' and (resid 396 through 485 )
10X-RAY DIFFRACTION10chain 'C' and (resid 67 through 186 )
11X-RAY DIFFRACTION11chain 'C' and (resid 187 through 353 )
12X-RAY DIFFRACTION12chain 'C' and (resid 354 through 485 )

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more