[English] 日本語
![](img/lk-miru.gif)
- PDB-5c51: Probing the Structural and Molecular Basis of Nucleotide Selectiv... -
+
Open data
-
Basic information
Entry | Database: PDB / ID: 5c51 | ||||||
---|---|---|---|---|---|---|---|
Title | Probing the Structural and Molecular Basis of Nucleotide Selectivity by Human Mitochondrial DNA Polymerase gamma | ||||||
![]() |
| ||||||
![]() | transferase/dna / Nucleoside reverse transcriptase inhibitors (NRTIs) / HIV RT / human mitochondrial DNA polymerase / mitochondrial toxicity / drug efficacy and toxicity / transferase-dna complex | ||||||
Function / homology | ![]() gamma DNA polymerase complex / mitochondrial DNA replication / positive regulation of DNA-directed DNA polymerase activity / single-stranded DNA 3'-5' DNA exonuclease activity / Hydrolases; Acting on ester bonds; Exodeoxyribonucleases producing 5'-phosphomonoesters / DNA replication proofreading / DNA metabolic process / DNA polymerase processivity factor activity / mitochondrial nucleoid / Lyases; Carbon-oxygen lyases; Other carbon-oxygen lyases ...gamma DNA polymerase complex / mitochondrial DNA replication / positive regulation of DNA-directed DNA polymerase activity / single-stranded DNA 3'-5' DNA exonuclease activity / Hydrolases; Acting on ester bonds; Exodeoxyribonucleases producing 5'-phosphomonoesters / DNA replication proofreading / DNA metabolic process / DNA polymerase processivity factor activity / mitochondrial nucleoid / Lyases; Carbon-oxygen lyases; Other carbon-oxygen lyases / 5'-deoxyribose-5-phosphate lyase activity / DNA polymerase binding / 3'-5' exonuclease activity / base-excision repair, gap-filling / Transcriptional activation of mitochondrial biogenesis / base-excision repair / DNA-templated DNA replication / double-stranded DNA binding / protease binding / in utero embryonic development / DNA-directed DNA polymerase / DNA-directed DNA polymerase activity / mitochondrial matrix / intracellular membrane-bounded organelle / chromatin binding / protein-containing complex / mitochondrion / DNA binding / identical protein binding / cytoplasm Similarity search - Function | ||||||
Biological species | ![]() ![]() DNA launch vector pDE-GFP2 (others) | ||||||
Method | ![]() ![]() | ||||||
![]() | Sohl, C.D. / Szymanski, M.R. / Mislak, A.C. / Shumate, C.K. / Amiralaei, S. / Schinazi, R.F. / Anderson, K.S. / Whitney, Y.Y. | ||||||
![]() | ![]() Title: Probing the structural and molecular basis of nucleotide selectivity by human mitochondrial DNA polymerase gamma. Authors: Sohl, C.D. / Szymanski, M.R. / Mislak, A.C. / Shumate, C.K. / Amiralaei, S. / Schinazi, R.F. / Anderson, K.S. / Yin, Y.W. | ||||||
History |
|
-
Structure visualization
Structure viewer | Molecule: ![]() ![]() |
---|
-
Downloads & links
-
Download
PDBx/mmCIF format | ![]() | 381.8 KB | Display | ![]() |
---|---|---|---|---|
PDB format | ![]() | 308.9 KB | Display | ![]() |
PDBx/mmJSON format | ![]() | Tree view | ![]() | |
Others | ![]() |
-Validation report
Summary document | ![]() | 825.6 KB | Display | ![]() |
---|---|---|---|---|
Full document | ![]() | 886.3 KB | Display | |
Data in XML | ![]() | 63.9 KB | Display | |
Data in CIF | ![]() | 84.8 KB | Display | |
Arichive directory | ![]() ![]() | HTTPS FTP |
-Related structure data
-
Links
-
Assembly
Deposited unit | ![]()
| ||||||||
---|---|---|---|---|---|---|---|---|---|
1 |
| ||||||||
Unit cell |
|
-
Components
-DNA polymerase subunit gamma- ... , 2 types, 3 molecules ABC
#1: Protein | Mass: 136033.531 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() Production host: Insect cell expression vector pTIE1 (others) References: UniProt: P54098, DNA-directed DNA polymerase |
---|---|
#2: Protein | Mass: 54991.000 Da / Num. of mol.: 2 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() Production host: Insect cell expression vector pTIE1 (others) References: UniProt: Q9UHN1, DNA-directed DNA polymerase |
-DNA chain , 2 types, 2 molecules PT
#3: DNA chain | Mass: 6779.408 Da / Num. of mol.: 1 / Source method: obtained synthetically / Details: AAAACGAGGGCCAGTGCCGTAC / Source: (synth.) ![]() |
---|---|
#4: DNA chain | Mass: 7672.917 Da / Num. of mol.: 1 / Source method: obtained synthetically / Source: (synth.) DNA launch vector pDE-GFP2 (others) |
-Non-polymers , 2 types, 3 molecules ![](data/chem/img/MG.gif)
![](data/chem/img/1RY.gif)
![](data/chem/img/1RY.gif)
#5: Chemical | #6: Chemical | ChemComp-1RY / [[( | |
---|
-Experimental details
-Experiment
Experiment | Method: ![]() |
---|
-
Sample preparation
Crystal | Density Matthews: 3.68 Å3/Da / Density % sol: 66.62 % |
---|---|
Crystal grow | Temperature: 300 K / Method: vapor diffusion, sitting drop / pH: 6.5 / Details: PEG4000, KCl, HEPES |
-Data collection
Diffraction | Mean temperature: 100 K |
---|---|
Diffraction source | Source: ![]() ![]() ![]() |
Detector | Type: ADSC QUANTUM 315r / Detector: CCD / Date: Aug 1, 2014 |
Radiation | Protocol: SINGLE WAVELENGTH / Monochromatic (M) / Laue (L): M / Scattering type: x-ray |
Radiation wavelength | Wavelength: 1 Å / Relative weight: 1 |
Reflection | Resolution: 3.42→50 Å / Num. obs: 50770 / % possible obs: 95 % / Redundancy: 8 % / Net I/σ(I): 2 |
-
Processing
Software |
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Refinement | Resolution: 3.426→47.017 Å / SU ML: 0.66 / Cross valid method: FREE R-VALUE / σ(F): 1.33 / Phase error: 43.46 / Stereochemistry target values: ML
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Solvent computation | Shrinkage radii: 0.9 Å / VDW probe radii: 1.11 Å / Solvent model: FLAT BULK SOLVENT MODEL | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Refinement step | Cycle: LAST / Resolution: 3.426→47.017 Å
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Refine LS restraints |
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
LS refinement shell |
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Refinement TLS params. | Method: refined / Refine-ID: X-RAY DIFFRACTION
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Refinement TLS group |
|