[English] 日本語
Yorodumi
- PDB-2m6w: Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadrup... -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 2m6w
TitleSolution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions
ComponentsDNA (5'-D(*GP*GP*GP*GP*TP*TP*GP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*GP*AP*AP*GP*GP*GP*G)-3')
KeywordsDNA / G-Quadruplex / Folding Topology
Function / homologyDNA / DNA (> 10)
Function and homology information
MethodSOLUTION NMR / simulated annealing, molecular dynamics
Model detailslowest energy, model1
AuthorsKarsisiotis, A.I. / Webba da Silva, M.
CitationJournal: Sci Adv / Year: 2018
Title: Encoding canonical DNA quadruplex structure.
Authors: Dvorkin, S.A. / Karsisiotis, A.I. / Webba da Silva, M.
History
DepositionApr 19, 2013Deposition site: BMRB / Processing site: RCSB
Revision 1.0Jul 23, 2014Provider: repository / Type: Initial release
Revision 1.1Oct 22, 2014Group: Structure summary
Revision 1.2Aug 29, 2018Group: Data collection / Database references / Category: citation / citation_author
Item: _citation.country / _citation.journal_abbrev ..._citation.country / _citation.journal_abbrev / _citation.journal_id_CSD / _citation.journal_id_ISSN / _citation.journal_volume / _citation.pdbx_database_id_DOI / _citation.title / _citation.year
Revision 1.3Oct 31, 2018Group: Data collection / Database references / Category: citation / citation_author
Item: _citation.page_first / _citation.page_last ..._citation.page_first / _citation.page_last / _citation.pdbx_database_id_PubMed / _citation.title / _citation_author.identifier_ORCID
Revision 1.4Jun 14, 2023Group: Data collection / Database references / Other
Category: database_2 / pdbx_database_status / pdbx_nmr_software
Item: _database_2.pdbx_DOI / _database_2.pdbx_database_accession ..._database_2.pdbx_DOI / _database_2.pdbx_database_accession / _pdbx_database_status.status_code_nmr_data / _pdbx_nmr_software.name
Revision 1.5May 15, 2024Group: Data collection / Database references / Category: chem_comp_atom / chem_comp_bond / database_2 / Item: _database_2.pdbx_DOI

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
A: DNA (5'-D(*GP*GP*GP*GP*TP*TP*GP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*GP*AP*AP*GP*GP*GP*G)-3')


Theoretical massNumber of molelcules
Total (without water)7,6741
Polymers7,6741
Non-polymers00
Water00
1


  • Idetical with deposited unit
  • defined by author
TypeNameSymmetry operationNumber
identity operation1_555x,y,z1
NMR ensembles
DataCriteria
Number of conformers (submitted / calculated)8 / 100structures with the lowest energy
RepresentativeModel #1lowest energy

-
Components

#1: DNA chain DNA (5'-D(*GP*GP*GP*GP*TP*TP*GP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*GP*AP*AP*GP*GP*GP*G)-3')


Mass: 7673.907 Da / Num. of mol.: 1 / Source method: obtained synthetically

-
Experimental details

-
Experiment

ExperimentMethod: SOLUTION NMR
NMR experiment
Conditions-IDExperiment-IDSolution-IDType
1112D 1H-1H NOESY
2222D 1H-1H NOESY
2322D 1H-1H TOCSY
2422D DQF-COSY
1512D [1H-13C] H1(C5)H8 JR HMBC
2622D [1H-31P]-HSQC

-
Sample preparation

Details
Solution-IDContentsSolvent system
15 mM DNA (5'-D(*GP*GP*GP*GP*TP*TP*GP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*GP*AP*AP*GP*GP*GP*G)-3'), 20 mM sodium phosphate, 93% H2O/7% D2O93% H2O/7% D2O
25 mM DNA (5'-D(*GP*GP*GP*GP*TP*TP*GP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*GP*AP*AP*GP*GP*GP*G)-3'), 20 mM sodium phosphate, 100% D2O100% D2O
Sample
Conc. (mg/ml)UnitsComponentConc. range (mg/ml)Solution-ID
mMDNA (5'-D(*GP*GP*GP*GP*TP*TP*GP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*GP*AP*AP*GP*GP*GP*G)-3')-151
20 mMsodium phosphate-21
mMDNA (5'-D(*GP*GP*GP*GP*TP*TP*GP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*GP*AP*AP*GP*GP*GP*G)-3')-352
20 mMsodium phosphate-42
Sample conditions
Conditions-IDIonic strengthpHPressure (kPa)Temperature (K)
1257.8ambient 278 K
2257.8ambient 293 K

-
NMR measurement

NMR spectrometerType: Varian VNMRS 500 / Manufacturer: Varian / Model: VNMRS 500 / Field strength: 500 MHz

-
Processing

NMR software
NameDeveloperClassification
FelixAccelrys Software Inc.processing
SparkyGoddardchemical shift assignment
SparkyGoddarddata analysis
X-PLORBrungerstructure solution
X-PLORBrungerrefinement
X-PLOR NIHSchwieters, Kuszewski, Tjandra and Clorestructure solution
X-PLOR NIHSchwieters, Kuszewski, Tjandra and Clorerefinement
MOLMOLKoradi, Billeter and Wuthrichdata analysis
VnmrJVariancollection
RefinementMethod: simulated annealing, molecular dynamics / Software ordinal: 1
NMR constraintsNOE constraints total: 1024 / NOE intraresidue total count: 496 / NOE long range total count: 209 / NOE medium range total count: 68 / NOE sequential total count: 251
NMR representativeSelection criteria: lowest energy
NMR ensembleConformer selection criteria: structures with the lowest energy
Conformers calculated total number: 100 / Conformers submitted total number: 8

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more