+
Open data
-
Basic information
| Entry | Database: EMDB / ID: EMD-3948 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Title | Nucleosome breathing : Class 2 | |||||||||
Map data | Nucleosome breathing : Class 2 | |||||||||
Sample |
| |||||||||
Keywords | nucleosome / nucleosome breathing / hexasome / GENE REGULATION | |||||||||
| Function / homology | Function and homology informationstructural constituent of chromatin / nucleosome / heterochromatin formation / nucleosome assembly / protein heterodimerization activity / DNA binding / nucleoplasm / nucleus Similarity search - Function | |||||||||
| Biological species | ||||||||||
| Method | single particle reconstruction / cryo EM / Resolution: 5.4 Å | |||||||||
Authors | Bilokapic S / Halic M | |||||||||
| Funding support | 1 items
| |||||||||
Citation | Journal: Nat Struct Mol Biol / Year: 2018Title: Histone octamer rearranges to adapt to DNA unwrapping. Authors: Silvija Bilokapic / Mike Strauss / Mario Halic / ![]() Abstract: Nucleosomes, the basic units of chromatin, package and regulate expression of eukaryotic genomes. Although the structure of the intact nucleosome is well characterized, little is known about ...Nucleosomes, the basic units of chromatin, package and regulate expression of eukaryotic genomes. Although the structure of the intact nucleosome is well characterized, little is known about structures of partially unwrapped, transient intermediates. In this study, we present nine cryo-EM structures of distinct conformations of nucleosome and subnucleosome particles. These structures show that initial DNA breathing induces conformational changes in the histone octamer, particularly in histone H3, that propagate through the nucleosome and prevent symmetrical DNA opening. Rearrangements in the H2A-H2B dimer strengthen interaction with the unwrapping DNA and promote nucleosome stability. In agreement with this, cross-linked H2A-H2B that cannot accommodate unwrapping of the DNA is not stably maintained in the nucleosome. H2A-H2B release and DNA unwrapping occur simultaneously, indicating that DNA is essential in stabilizing the dimer in the nucleosome. Our structures reveal intrinsic nucleosomal plasticity that is required for nucleosome stability and might be exploited by extrinsic protein factors. | |||||||||
| History |
|
-
Structure visualization
| Movie |
Movie viewer |
|---|---|
| Structure viewer | EM map: SurfView Molmil Jmol/JSmol |
| Supplemental images |
-
Downloads & links
-EMDB archive
| Map data | emd_3948.map.gz | 11.9 MB | EMDB map data format | |
|---|---|---|---|---|
| Header (meta data) | emd-3948-v30.xml emd-3948.xml | 22.5 KB 22.5 KB | Display Display | EMDB header |
| Images | emd_3948.png | 263.2 KB | ||
| Filedesc metadata | emd-3948.cif.gz | 6.7 KB | ||
| Archive directory | http://ftp.pdbj.org/pub/emdb/structures/EMD-3948 ftp://ftp.pdbj.org/pub/emdb/structures/EMD-3948 | HTTPS FTP |
-Validation report
| Summary document | emd_3948_validation.pdf.gz | 398.8 KB | Display | EMDB validaton report |
|---|---|---|---|---|
| Full document | emd_3948_full_validation.pdf.gz | 398.4 KB | Display | |
| Data in XML | emd_3948_validation.xml.gz | 5.6 KB | Display | |
| Data in CIF | emd_3948_validation.cif.gz | 6.4 KB | Display | |
| Arichive directory | https://ftp.pdbj.org/pub/emdb/validation_reports/EMD-3948 ftp://ftp.pdbj.org/pub/emdb/validation_reports/EMD-3948 | HTTPS FTP |
-Related structure data
| Related structure data | ![]() 6esgMC ![]() 3925C ![]() 3926C ![]() 3929C ![]() 3930C ![]() 3931C ![]() 3947C ![]() 3949C ![]() 3950C ![]() 6esfC ![]() 6eshC ![]() 6esiC M: atomic model generated by this map C: citing same article ( |
|---|---|
| Similar structure data |
-
Links
| EMDB pages | EMDB (EBI/PDBe) / EMDataResource |
|---|---|
| Related items in Molecule of the Month |
-
Map
| File | Download / File: emd_3948.map.gz / Format: CCP4 / Size: 18.1 MB / Type: IMAGE STORED AS FLOATING POINT NUMBER (4 BYTES) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Annotation | Nucleosome breathing : Class 2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Projections & slices | Image control
Images are generated by Spider. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Voxel size | X=Y=Z: 1.4 Å | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Density |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Symmetry | Space group: 1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Details | EMDB XML:
CCP4 map header:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
-Supplemental data
-
Sample components
-Entire : Nucleosome
| Entire | Name: Nucleosome |
|---|---|
| Components |
|
-Supramolecule #1: Nucleosome
| Supramolecule | Name: Nucleosome / type: complex / ID: 1 / Parent: 0 / Macromolecule list: all |
|---|---|
| Molecular weight | Theoretical: 200 KDa |
-Supramolecule #2: histones
| Supramolecule | Name: histones / type: complex / ID: 2 / Parent: 1 / Macromolecule list: #1-#4 |
|---|---|
| Source (natural) | Organism: |
-Supramolecule #3: DNA
| Supramolecule | Name: DNA / type: complex / ID: 3 / Parent: 1 / Macromolecule list: #5-#6 |
|---|---|
| Source (natural) | Organism: Synthetic construct (others) |
-Macromolecule #1: Histone H3.2
| Macromolecule | Name: Histone H3.2 / type: protein_or_peptide / ID: 1 / Number of copies: 2 / Enantiomer: LEVO |
|---|---|
| Source (natural) | Organism: |
| Molecular weight | Theoretical: 15.30393 KDa |
| Recombinant expression | Organism: ![]() |
| Sequence | String: ARTKQTARKS TGGKAPRKQL ATKAARKSAP ATGGVKKPHR YRPGTVALRE IRRYQKSTEL LIRKLPFQRL VREIAQDFKT DLRFQSSAV MALQEASEAY LVALFEDTNL CAIHAKRVTI MPKDIQLARR IRGERA UniProtKB: Histone H3.2 |
-Macromolecule #2: Histone H4
| Macromolecule | Name: Histone H4 / type: protein_or_peptide / ID: 2 / Number of copies: 2 / Enantiomer: LEVO |
|---|---|
| Source (natural) | Organism: |
| Molecular weight | Theoretical: 11.263231 KDa |
| Recombinant expression | Organism: ![]() |
| Sequence | String: SGRGKGGKGL GKGGAKRHRK VLRDNIQGIT KPAIRRLARR GGVKRISGLI YEETRGVLKV FLENVIRDAV TYTEHAKRKT VTAMDVVYA LKRQGRTLYG FGG UniProtKB: Histone H4 |
-Macromolecule #3: Histone H2A
| Macromolecule | Name: Histone H2A / type: protein_or_peptide / ID: 3 / Number of copies: 2 / Enantiomer: LEVO |
|---|---|
| Source (natural) | Organism: |
| Molecular weight | Theoretical: 13.978241 KDa |
| Recombinant expression | Organism: ![]() |
| Sequence | String: SGRGKQGGKT RAKAKTRSSR AGLQFPVGRV HRLLRKGNYA ERVGAGAPVY LAAVLEYLTA EILELAGNAA RDNKKTRIIP RHLQLAVRN DEELNKLLGR VTIAQGGVLP NIQSVLLPKK TESSKSAKSK UniProtKB: Histone H2A |
-Macromolecule #4: Histone H2B 1.1
| Macromolecule | Name: Histone H2B 1.1 / type: protein_or_peptide / ID: 4 / Number of copies: 2 / Enantiomer: LEVO |
|---|---|
| Source (natural) | Organism: |
| Molecular weight | Theoretical: 13.524752 KDa |
| Recombinant expression | Organism: ![]() |
| Sequence | String: AKSAPAPKKG SKKAVTKTQK KDGKKRRKTR KESYAIYVYK VLKQVHPDTG ISSKAMSIMN SFVNDVFERI AGEASRLAHY NKRSTITSR EIQTAVRLLL PGELAKHAVS EGTKAVTKYT SAK UniProtKB: Histone H2B 1.1 |
-Macromolecule #5: DNA (141-MER)
| Macromolecule | Name: DNA (141-MER) / type: dna / ID: 5 / Number of copies: 1 / Classification: DNA |
|---|---|
| Source (natural) | Organism: synthetic construct (others) |
| Molecular weight | Theoretical: 45.604047 KDa |
| Sequence | String: (DA)(DC)(DA)(DG)(DG)(DA)(DT)(DG)(DT)(DA) (DT)(DA)(DT)(DA)(DT)(DC)(DT)(DG)(DA)(DC) (DA)(DC)(DG)(DT)(DG)(DC)(DC)(DT)(DG) (DG)(DA)(DG)(DA)(DC)(DT)(DA)(DG)(DG)(DG) (DA) (DG)(DT)(DA)(DA)(DT)(DC) ...String: (DA)(DC)(DA)(DG)(DG)(DA)(DT)(DG)(DT)(DA) (DT)(DA)(DT)(DA)(DT)(DC)(DT)(DG)(DA)(DC) (DA)(DC)(DG)(DT)(DG)(DC)(DC)(DT)(DG) (DG)(DA)(DG)(DA)(DC)(DT)(DA)(DG)(DG)(DG) (DA) (DG)(DT)(DA)(DA)(DT)(DC)(DC)(DC) (DC)(DT)(DT)(DG)(DG)(DC)(DG)(DG)(DT)(DT) (DA)(DA) (DA)(DA)(DC)(DG)(DC)(DG)(DG) (DG)(DG)(DG)(DA)(DC)(DA)(DG)(DC)(DG)(DC) (DG)(DT)(DA) (DC)(DG)(DT)(DG)(DC)(DG) (DT)(DT)(DT)(DA)(DA)(DG)(DC)(DG)(DG)(DT) (DG)(DC)(DT)(DA) (DG)(DA)(DG)(DC)(DT) (DG)(DT)(DC)(DT)(DA)(DC)(DG)(DA)(DC)(DC) (DA)(DA)(DT)(DT)(DG) (DA)(DG)(DC)(DG) (DG)(DC)(DC)(DT)(DC)(DG)(DG)(DC)(DA)(DC) (DC)(DG)(DG)(DG)(DA)(DT) (DT)(DC)(DT) (DC)(DC)(DA)(DG) |
-Macromolecule #6: DNA (141-MER)
| Macromolecule | Name: DNA (141-MER) / type: dna / ID: 6 Details: CTGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCC CCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCTGT Number of copies: 1 / Classification: DNA |
|---|---|
| Source (natural) | Organism: synthetic construct (others) |
| Molecular weight | Theoretical: 45.145754 KDa |
| Sequence | String: (DC)(DT)(DG)(DG)(DA)(DG)(DA)(DA)(DT)(DC) (DC)(DC)(DG)(DG)(DT)(DG)(DC)(DC)(DG)(DA) (DG)(DG)(DC)(DC)(DG)(DC)(DT)(DC)(DA) (DA)(DT)(DT)(DG)(DG)(DT)(DC)(DG)(DT)(DA) (DG) (DA)(DC)(DA)(DG)(DC)(DT) ...String: (DC)(DT)(DG)(DG)(DA)(DG)(DA)(DA)(DT)(DC) (DC)(DC)(DG)(DG)(DT)(DG)(DC)(DC)(DG)(DA) (DG)(DG)(DC)(DC)(DG)(DC)(DT)(DC)(DA) (DA)(DT)(DT)(DG)(DG)(DT)(DC)(DG)(DT)(DA) (DG) (DA)(DC)(DA)(DG)(DC)(DT)(DC)(DT) (DA)(DG)(DC)(DA)(DC)(DC)(DG)(DC)(DT)(DT) (DA)(DA) (DA)(DC)(DG)(DC)(DA)(DC)(DG) (DT)(DA)(DC)(DG)(DC)(DG)(DC)(DT)(DG)(DT) (DC)(DC)(DC) (DC)(DC)(DG)(DC)(DG)(DT) (DT)(DT)(DT)(DA)(DA)(DC)(DC)(DG)(DC)(DC) (DA)(DA)(DG)(DG) (DG)(DG)(DA)(DT)(DT) (DA)(DC)(DT)(DC)(DC)(DC)(DT)(DA)(DG)(DT) (DC)(DT)(DC)(DC)(DA) (DG)(DG)(DC)(DA) (DC)(DG)(DT)(DG)(DT)(DC)(DA)(DG)(DA)(DT) (DA)(DT)(DA)(DT)(DA)(DC) (DA)(DT)(DC) (DC)(DT)(DG)(DT) |
-Experimental details
-Structure determination
| Method | cryo EM |
|---|---|
Processing | single particle reconstruction |
| Aggregation state | particle |
-
Sample preparation
| Buffer | pH: 7.4 |
|---|---|
| Vitrification | Cryogen name: ETHANE |
-
Electron microscopy
| Microscope | FEI TITAN |
|---|---|
| Image recording | #0 - Image recording ID: 1 / #0 - Film or detector model: GATAN K2 SUMMIT (4k x 4k) / #0 - Detector mode: COUNTING / #0 - Average electron dose: 80.0 e/Å2 / #1 - Image recording ID: 2 / #1 - Film or detector model: FEI FALCON II (4k x 4k) / #1 - Detector mode: INTEGRATING / #1 - Average electron dose: 100.0 e/Å2 |
| Electron beam | Acceleration voltage: 300 kV / Electron source: FIELD EMISSION GUN |
| Electron optics | Illumination mode: FLOOD BEAM / Imaging mode: BRIGHT FIELD |
Movie
Controller
About Yorodumi



Keywords
Authors
Citation
UCSF Chimera























Z (Sec.)
Y (Row.)
X (Col.)






















Processing
