+
Open data
-
Basic information
| Entry | Database: PDB / ID: 6esg | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Title | Nucleosome breathing : Class 2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Components |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Keywords | GENE REGULATION / nucleosome / nucleosome breathing / hexasome | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Function / homology | Function and homology informationstructural constituent of chromatin / heterochromatin formation / nucleosome / nucleosome assembly / protein heterodimerization activity / DNA binding / nucleoplasm / nucleus Similarity search - Function | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Biological species | synthetic construct (others) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Method | ELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 5.4 Å | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Bilokapic, S. / Halic, M. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Funding support | 1items
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Citation | Journal: Nat Struct Mol Biol / Year: 2018Title: Histone octamer rearranges to adapt to DNA unwrapping. Authors: Silvija Bilokapic / Mike Strauss / Mario Halic / ![]() Abstract: Nucleosomes, the basic units of chromatin, package and regulate expression of eukaryotic genomes. Although the structure of the intact nucleosome is well characterized, little is known about ...Nucleosomes, the basic units of chromatin, package and regulate expression of eukaryotic genomes. Although the structure of the intact nucleosome is well characterized, little is known about structures of partially unwrapped, transient intermediates. In this study, we present nine cryo-EM structures of distinct conformations of nucleosome and subnucleosome particles. These structures show that initial DNA breathing induces conformational changes in the histone octamer, particularly in histone H3, that propagate through the nucleosome and prevent symmetrical DNA opening. Rearrangements in the H2A-H2B dimer strengthen interaction with the unwrapping DNA and promote nucleosome stability. In agreement with this, cross-linked H2A-H2B that cannot accommodate unwrapping of the DNA is not stably maintained in the nucleosome. H2A-H2B release and DNA unwrapping occur simultaneously, indicating that DNA is essential in stabilizing the dimer in the nucleosome. Our structures reveal intrinsic nucleosomal plasticity that is required for nucleosome stability and might be exploited by extrinsic protein factors. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| History |
|
-
Structure visualization
| Movie |
Movie viewer |
|---|---|
| Structure viewer | Molecule: Molmil Jmol/JSmol |
-
Downloads & links
-
Download
| PDBx/mmCIF format | 6esg.cif.gz | 275.7 KB | Display | PDBx/mmCIF format |
|---|---|---|---|---|
| PDB format | pdb6esg.ent.gz | 205.9 KB | Display | PDB format |
| PDBx/mmJSON format | 6esg.json.gz | Tree view | PDBx/mmJSON format | |
| Others | Other downloads |
-Validation report
| Summary document | 6esg_validation.pdf.gz | 826.6 KB | Display | wwPDB validaton report |
|---|---|---|---|---|
| Full document | 6esg_full_validation.pdf.gz | 843.3 KB | Display | |
| Data in XML | 6esg_validation.xml.gz | 30.2 KB | Display | |
| Data in CIF | 6esg_validation.cif.gz | 48.1 KB | Display | |
| Arichive directory | https://data.pdbj.org/pub/pdb/validation_reports/es/6esg ftp://data.pdbj.org/pub/pdb/validation_reports/es/6esg | HTTPS FTP |
-Related structure data
| Related structure data | ![]() 3948MC ![]() 3925C ![]() 3926C ![]() 3929C ![]() 3930C ![]() 3931C ![]() 3947C ![]() 3949C ![]() 3950C ![]() 6esfC ![]() 6eshC ![]() 6esiC M: map data used to model this data C: citing same article ( |
|---|---|
| Similar structure data |
-
Links
-
Assembly
| Deposited unit | ![]()
|
|---|---|
| 1 |
|
-
Components
-Protein , 4 types, 8 molecules AEBFCGDH
| #1: Protein | Mass: 15303.930 Da / Num. of mol.: 2 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() #2: Protein | Mass: 11263.231 Da / Num. of mol.: 2 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() #3: Protein | Mass: 13978.241 Da / Num. of mol.: 2 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() #4: Protein | Mass: 13524.752 Da / Num. of mol.: 2 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() |
|---|
-DNA chain , 2 types, 2 molecules IJ
| #5: DNA chain | Mass: 45604.047 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) synthetic construct (others) / Production host: synthetic construct (others) |
|---|---|
| #6: DNA chain | Mass: 45145.754 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Details: CTGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCC CCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCTGT Source: (gene. exp.) synthetic construct (others) / Production host: synthetic construct (others) |
-Details
| Has protein modification | N |
|---|
-Experimental details
-Experiment
| Experiment | Method: ELECTRON MICROSCOPY |
|---|---|
| EM experiment | Aggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction |
-
Sample preparation
| Component |
| ||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Molecular weight | Value: 0.2 MDa | ||||||||||||||||||||||||
| Source (natural) |
| ||||||||||||||||||||||||
| Source (recombinant) |
| ||||||||||||||||||||||||
| Buffer solution | pH: 7.4 | ||||||||||||||||||||||||
| Specimen | Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES | ||||||||||||||||||||||||
| Vitrification | Cryogen name: ETHANE |
-
Electron microscopy imaging
| Microscopy | Model: FEI TITAN | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Electron gun | Electron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: FLOOD BEAM | |||||||||||||||
| Electron lens | Mode: BRIGHT FIELD | |||||||||||||||
| Image recording |
|
-
Processing
| Software | Name: PHENIX / Version: 1.11.1_2575: / Classification: refinement | ||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| EM software |
| ||||||||||||||||||||||||
| Image processing | Details: Data were collected on Titan Halo with Falcon II and Titan Krios with K2 | ||||||||||||||||||||||||
| CTF correction | Type: PHASE FLIPPING AND AMPLITUDE CORRECTION | ||||||||||||||||||||||||
| Symmetry | Point symmetry: C1 (asymmetric) | ||||||||||||||||||||||||
| 3D reconstruction | Resolution: 5.4 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 14000 / Symmetry type: POINT | ||||||||||||||||||||||||
| Refine LS restraints |
|
Movie
Controller
About Yorodumi





Citation
UCSF Chimera





















PDBj








































