[English] 日本語
Yorodumi
- PDB-6esg: Nucleosome breathing : Class 2 -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 6esg
TitleNucleosome breathing : Class 2
Components
  • (DNA (141-MER)) x 2
  • Histone H2A
  • Histone H2B 1.1
  • Histone H3.2
  • Histone H4
KeywordsGENE REGULATION / nucleosome / nucleosome breathing / hexasome
Function / homology
Function and homology information


structural constituent of chromatin / heterochromatin formation / nucleosome / nucleosome assembly / protein heterodimerization activity / DNA binding / nucleoplasm / nucleus
Similarity search - Function
: / Histone H2A conserved site / Histone H2A signature. / Histone H2B signature. / Histone H2B / Histone H2B / Histone H2A, C-terminal domain / C-terminus of histone H2A / Histone 2A / Histone H2A ...: / Histone H2A conserved site / Histone H2A signature. / Histone H2B signature. / Histone H2B / Histone H2B / Histone H2A, C-terminal domain / C-terminus of histone H2A / Histone 2A / Histone H2A / TATA box binding protein associated factor / TATA box binding protein associated factor (TAF), histone-like fold domain / Histone H4, conserved site / Histone H4 signature. / Histone H4 / Histone H4 / CENP-T/Histone H4, histone fold / Centromere kinetochore component CENP-T histone fold / Histone H3 signature 1. / Histone H3 signature 2. / Histone H3 / Histone H3/CENP-A / Histone H2A/H2B/H3 / Core histone H2A/H2B/H3/H4 domain / Histone-fold
Similarity search - Domain/homology
DNA / DNA (> 10) / DNA (> 100) / Histone H2B 1.1 / Histone H4 / Histone H3.2 / Histone H2A
Similarity search - Component
Biological speciesXenopus laevis (African clawed frog)
synthetic construct (others)
MethodELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 5.4 Å
AuthorsBilokapic, S. / Halic, M.
Funding support1items
OrganizationGrant numberCountry
European Research CouncilERC-smallRNAhet-309584
CitationJournal: Nat Struct Mol Biol / Year: 2018
Title: Histone octamer rearranges to adapt to DNA unwrapping.
Authors: Silvija Bilokapic / Mike Strauss / Mario Halic /
Abstract: Nucleosomes, the basic units of chromatin, package and regulate expression of eukaryotic genomes. Although the structure of the intact nucleosome is well characterized, little is known about ...Nucleosomes, the basic units of chromatin, package and regulate expression of eukaryotic genomes. Although the structure of the intact nucleosome is well characterized, little is known about structures of partially unwrapped, transient intermediates. In this study, we present nine cryo-EM structures of distinct conformations of nucleosome and subnucleosome particles. These structures show that initial DNA breathing induces conformational changes in the histone octamer, particularly in histone H3, that propagate through the nucleosome and prevent symmetrical DNA opening. Rearrangements in the H2A-H2B dimer strengthen interaction with the unwrapping DNA and promote nucleosome stability. In agreement with this, cross-linked H2A-H2B that cannot accommodate unwrapping of the DNA is not stably maintained in the nucleosome. H2A-H2B release and DNA unwrapping occur simultaneously, indicating that DNA is essential in stabilizing the dimer in the nucleosome. Our structures reveal intrinsic nucleosomal plasticity that is required for nucleosome stability and might be exploited by extrinsic protein factors.
History
DepositionOct 20, 2017Deposition site: PDBE / Processing site: PDBE
Revision 1.0Dec 20, 2017Provider: repository / Type: Initial release
Revision 1.0Dec 20, 2017Data content type: EM metadata / Data content type: EM metadata / Provider: repository / Type: Initial release
Revision 1.0Dec 20, 2017Data content type: Image / Data content type: Image / Provider: repository / Type: Initial release
Revision 1.0Dec 20, 2017Data content type: Primary map / Data content type: Primary map / Provider: repository / Type: Initial release
Revision 1.0Dec 20, 2017Data content type: EM metadata / Data content type: EM metadata / Provider: repository / Type: Initial release
Revision 1.0Dec 20, 2017Data content type: Image / Data content type: Image / Provider: repository / Type: Initial release
Revision 1.0Dec 20, 2017Data content type: Primary map / Data content type: Primary map / Provider: repository / Type: Initial release
Revision 1.0Dec 20, 2017Data content type: EM metadata / Data content type: EM metadata / Provider: repository / Type: Initial release
Revision 1.0Dec 20, 2017Data content type: Image / Data content type: Image / Provider: repository / Type: Initial release
Revision 1.0Dec 20, 2017Data content type: Primary map / Data content type: Primary map / Provider: repository / Type: Initial release
Revision 1.0Dec 20, 2017Data content type: EM metadata / Data content type: EM metadata / Provider: repository / Type: Initial release
Revision 1.0Dec 20, 2017Data content type: Image / Data content type: Image / Provider: repository / Type: Initial release
Revision 1.0Dec 20, 2017Data content type: Primary map / Data content type: Primary map / Provider: repository / Type: Initial release
Revision 1.0Dec 20, 2017Data content type: EM metadata / Data content type: EM metadata / Provider: repository / Type: Initial release
Revision 1.0Dec 20, 2017Data content type: Image / Data content type: Image / Provider: repository / Type: Initial release
Revision 1.0Dec 20, 2017Data content type: Primary map / Data content type: Primary map / Provider: repository / Type: Initial release
Revision 1.0Dec 20, 2017Data content type: EM metadata / Data content type: EM metadata / Provider: repository / Type: Initial release
Revision 1.0Dec 20, 2017Data content type: Image / Data content type: Image / Provider: repository / Type: Initial release
Revision 1.0Dec 20, 2017Data content type: Primary map / Data content type: Primary map / Provider: repository / Type: Initial release
Revision 1.1Dec 27, 2017Group: Database references / Category: citation
Item: _citation.country / _citation.journal_abbrev ..._citation.country / _citation.journal_abbrev / _citation.journal_id_CSD / _citation.journal_id_ISSN / _citation.pdbx_database_id_DOI / _citation.title / _citation.year
Revision 1.2Jan 24, 2018Group: Database references / Category: citation
Item: _citation.journal_abbrev / _citation.journal_volume ..._citation.journal_abbrev / _citation.journal_volume / _citation.page_first / _citation.page_last / _citation.pdbx_database_id_PubMed / _citation.title / _citation.year
Revision 1.3Oct 2, 2019Group: Data collection / Other / Category: atom_sites / cell
Item: _atom_sites.fract_transf_matrix[1][1] / _atom_sites.fract_transf_matrix[2][2] ..._atom_sites.fract_transf_matrix[1][1] / _atom_sites.fract_transf_matrix[2][2] / _atom_sites.fract_transf_matrix[3][3] / _cell.length_a / _cell.length_b / _cell.length_c
Revision 1.4Oct 23, 2019Group: Data collection / Other / Category: cell / Item: _cell.Z_PDB
Revision 1.5May 15, 2024Group: Data collection / Database references / Category: chem_comp_atom / chem_comp_bond / database_2
Item: _database_2.pdbx_DOI / _database_2.pdbx_database_accession
Revision 1.6Jul 9, 2025Group: Data collection / Structure summary / Category: em_admin / em_software / pdbx_entry_details / Item: _em_admin.last_update / _em_software.name
Revision 1.1Jul 9, 2025Data content type: EM metadata / Data content type: EM metadata / EM metadata / Group: Data processing / Experimental summary / Data content type: EM metadata / EM metadata / Category: em_admin / em_software / Data content type: EM metadata / EM metadata / Item: _em_admin.last_update / _em_software.name

-
Structure visualization

Movie
  • Deposited structure unit
  • Imaged by Jmol
  • Download
  • Superimposition on EM map
  • EMDB-3948
  • Imaged by UCSF Chimera
  • Download
Movie viewer
Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
A: Histone H3.2
B: Histone H4
C: Histone H2A
D: Histone H2B 1.1
E: Histone H3.2
F: Histone H4
G: Histone H2A
H: Histone H2B 1.1
I: DNA (141-MER)
J: DNA (141-MER)


Theoretical massNumber of molelcules
Total (without water)198,89010
Polymers198,89010
Non-polymers00
Water00
1


  • Idetical with deposited unit
  • defined by author&software
  • Evidence: gel filtration
TypeNameSymmetry operationNumber
identity operation1_555x,y,z1
Buried area51040 Å2
ΔGint-352 kcal/mol
Surface area71900 Å2
MethodPISA

-
Components

-
Protein , 4 types, 8 molecules AEBFCGDH

#1: Protein Histone H3.2


Mass: 15303.930 Da / Num. of mol.: 2
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Xenopus laevis (African clawed frog) / Production host: Escherichia coli (E. coli) / References: UniProt: P84233
#2: Protein Histone H4


Mass: 11263.231 Da / Num. of mol.: 2
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Xenopus laevis (African clawed frog) / Production host: Escherichia coli (E. coli) / References: UniProt: P62799
#3: Protein Histone H2A


Mass: 13978.241 Da / Num. of mol.: 2
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Xenopus laevis (African clawed frog) / Gene: hist1h2aj, LOC494591 / Production host: Escherichia coli (E. coli) / References: UniProt: Q6AZJ8
#4: Protein Histone H2B 1.1 / H2B1.1


Mass: 13524.752 Da / Num. of mol.: 2
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Xenopus laevis (African clawed frog) / Production host: Escherichia coli (E. coli) / References: UniProt: P02281

-
DNA chain , 2 types, 2 molecules IJ

#5: DNA chain DNA (141-MER)


Mass: 45604.047 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) synthetic construct (others) / Production host: synthetic construct (others)
#6: DNA chain DNA (141-MER)


Mass: 45145.754 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Details: CTGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCC CCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCTGT
Source: (gene. exp.) synthetic construct (others) / Production host: synthetic construct (others)

-
Details

Has protein modificationN

-
Experimental details

-
Experiment

ExperimentMethod: ELECTRON MICROSCOPY
EM experimentAggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction

-
Sample preparation

Component
IDNameTypeEntity IDParent-IDSource
1NucleosomeCOMPLEXall0MULTIPLE SOURCES
2histonesCOMPLEX#1-#41RECOMBINANT
3DNACOMPLEX#5-#61RECOMBINANT
Molecular weightValue: 0.2 MDa
Source (natural)
IDEntity assembly-IDOrganismNcbi tax-ID
22Xenopus laevis (African clawed frog)8355
33Synthetic construct (others)32630
Source (recombinant)
IDEntity assembly-IDOrganismNcbi tax-ID
22Escherichia coli (E. coli)562
33Synthetic contruct32630
Buffer solutionpH: 7.4
SpecimenEmbedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES
VitrificationCryogen name: ETHANE

-
Electron microscopy imaging

MicroscopyModel: FEI TITAN
Electron gunElectron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: FLOOD BEAM
Electron lensMode: BRIGHT FIELD
Image recording
IDImaging-IDElectron dose (e/Å2)Detector modeFilm or detector model
1180COUNTINGGATAN K2 SUMMIT (4k x 4k)
21100INTEGRATINGFEI FALCON II (4k x 4k)

-
Processing

SoftwareName: PHENIX / Version: 1.11.1_2575: / Classification: refinement
EM software
IDNameVersionCategory
8PHENIXmodel refinement
13RELION23D reconstruction
Image processingDetails: Data were collected on Titan Halo with Falcon II and Titan Krios with K2
CTF correctionType: PHASE FLIPPING AND AMPLITUDE CORRECTION
SymmetryPoint symmetry: C1 (asymmetric)
3D reconstructionResolution: 5.4 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 14000 / Symmetry type: POINT
Refine LS restraints
Refine-IDTypeDev idealNumber
ELECTRON MICROSCOPYf_bond_d0.00712294
ELECTRON MICROSCOPYf_angle_d0.95717824
ELECTRON MICROSCOPYf_dihedral_angle_d26.3736406
ELECTRON MICROSCOPYf_chiral_restr0.0552038
ELECTRON MICROSCOPYf_plane_restr0.0071278

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more