+
Open data
-
Basic information
Entry | Database: PDB / ID: 6esg | ||||||
---|---|---|---|---|---|---|---|
Title | Nucleosome breathing : Class 2 | ||||||
![]() |
| ||||||
![]() | ![]() ![]() | ||||||
Function / homology | ![]() DNA-templated transcription, initiation / ![]() ![]() ![]() ![]() | ||||||
Biological species | ![]() ![]() synthetic construct (others) | ||||||
Method | ![]() ![]() ![]() | ||||||
![]() | Bilokapic, S. / Halic, M. | ||||||
Funding support | 1items
| ||||||
![]() | ![]() Title: Histone octamer rearranges to adapt to DNA unwrapping. Authors: Silvija Bilokapic / Mike Strauss / Mario Halic / ![]() Abstract: Nucleosomes, the basic units of chromatin, package and regulate expression of eukaryotic genomes. Although the structure of the intact nucleosome is well characterized, little is known about ...Nucleosomes, the basic units of chromatin, package and regulate expression of eukaryotic genomes. Although the structure of the intact nucleosome is well characterized, little is known about structures of partially unwrapped, transient intermediates. In this study, we present nine cryo-EM structures of distinct conformations of nucleosome and subnucleosome particles. These structures show that initial DNA breathing induces conformational changes in the histone octamer, particularly in histone H3, that propagate through the nucleosome and prevent symmetrical DNA opening. Rearrangements in the H2A-H2B dimer strengthen interaction with the unwrapping DNA and promote nucleosome stability. In agreement with this, cross-linked H2A-H2B that cannot accommodate unwrapping of the DNA is not stably maintained in the nucleosome. H2A-H2B release and DNA unwrapping occur simultaneously, indicating that DNA is essential in stabilizing the dimer in the nucleosome. Our structures reveal intrinsic nucleosomal plasticity that is required for nucleosome stability and might be exploited by extrinsic protein factors. | ||||||
Validation Report | ![]() ![]() ![]() | ||||||
History |
|
-
Structure visualization
Movie |
![]() |
---|---|
Structure viewer | Molecule: ![]() ![]() |
-
Downloads & links
-
Download
PDBx/mmcif format | ![]() ![]() ![]() |
---|---|
PDB format | ![]() ![]() |
PDBML Plus | ![]() |
Others | ![]() |
-Related structure data
Related structure data | ![]() 3948CM ![]() 3925C ![]() 3926C ![]() 3929C ![]() 3930C ![]() 3931C ![]() 3947C ![]() 3949C ![]() 3950C ![]() 6esfC ![]() 6eshC ![]() 6esiC C: citing same article ( M: map data used to model this data |
---|---|
Similar-shape strucutres |
-
Links
-
Assembly
Deposited unit | ![]()
|
---|---|
1 |
|
-
Components
-Protein , 4 types, 8 molecules AEBFCGDH
#1: Protein | Mass: 15303.930 Da / Num. of mol.: 2 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() ![]() ![]() ![]() ![]() #2: Protein | ![]() Mass: 11263.231 Da / Num. of mol.: 2 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() ![]() ![]() ![]() ![]() #3: Protein | ![]() Mass: 13978.241 Da / Num. of mol.: 2 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() ![]() ![]() ![]() ![]() #4: Protein | Mass: 13524.752 Da / Num. of mol.: 2 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() ![]() ![]() ![]() ![]() |
---|
-DNA chain , 2 types, 2 molecules IJ
#5: DNA chain | Mass: 45604.047 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) synthetic construct (others) / Production host: synthetic construct (others) |
---|---|
#6: DNA chain | Mass: 45145.754 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Details: CTGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCC CCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCTGT Source: (gene. exp.) synthetic construct (others) / Production host: synthetic construct (others) |
-Experimental details
-Experiment
Experiment | Method: ![]() |
---|---|
EM experiment | Aggregation state: PARTICLE / 3D reconstruction method: ![]() |
-
Sample preparation
Component |
| ||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Molecular weight | Value: 0.2 MDa | ||||||||||||||||||||||||
Source (natural) |
| ||||||||||||||||||||||||
Source (recombinant) |
| ||||||||||||||||||||||||
Buffer solution | pH: 7.4 | ||||||||||||||||||||||||
Specimen | Embedding applied: NO / Shadowing applied: NO / Staining applied![]() ![]() | ||||||||||||||||||||||||
Vitrification![]() | Cryogen name: ETHANE |
-
Electron microscopy imaging
Microscopy | Model: FEI TITAN | |||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Electron gun | Electron source![]() ![]() | |||||||||||||||
Electron lens | Mode: BRIGHT FIELD![]() | |||||||||||||||
Image recording |
|
-
Processing
Software | Name: PHENIX / Version: 1.11.1_2575: / Classification: refinement | ||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
EM software | Name: RELION / Version: 2 / Category: 3D reconstruction![]() | ||||||||||||||||||||||||
Image processing | Details: Data were collected on Titan Halo with Falcon II and Titan Krios with K2 | ||||||||||||||||||||||||
CTF correction![]() | Type: PHASE FLIPPING AND AMPLITUDE CORRECTION | ||||||||||||||||||||||||
Symmetry | Point symmetry![]() | ||||||||||||||||||||||||
3D reconstruction![]() | Resolution: 5.4 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 14000 / Symmetry type: POINT | ||||||||||||||||||||||||
Refine LS restraints |
|