3CNM
 
 | | Crystal Structure of Phenazine Biosynthesis Protein PhzA/B from Burkholderia cepacia R18194, DHHA complex | | Descriptor: | (2S,3S)-TRANS-2,3-DIHYDRO-3-HYDROXYANTHRANILIC ACID, ACETATE ION, Phenazine biosynthesis protein A/B | | Authors: | Ahuja, E.G, Blankenfeldt, W. | | Deposit date: | 2008-03-26 | | Release date: | 2008-12-30 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (1.65 Å) | | Cite: | PhzA/B catalyzes the formation of the tricycle in phenazine biosynthesis.
J.Am.Chem.Soc., 130, 2008
|
|
4BYI
 | | Aurora A kinase bound to a highly selective imidazopyridine inhibitor | | Descriptor: | (S)-N-((1-(6-chloro-2-(1,3-dimethyl-1H-pyrazol-4-yl)-3H-imidazo[4,5-b]pyridin-7-yl)pyrrolidin-3-yl)methyl)acetamide, AURORA KINASE A | | Authors: | Joshi, A, Kosmopoulou, M, Bayliss, R. | | Deposit date: | 2013-07-19 | | Release date: | 2013-11-20 | | Last modified: | 2023-12-20 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Aurora Isoform Selectivity: Design and Synthesis of Imidazo[4,5-B]Pyridine Derivatives as Highly Selective Inhibitors of Aurora-A Kinase in Cells.
J.Med.Chem., 56, 2013
|
|
1JSX
 | |
4HXW
 | | Pyrrolopyrimidine inhibitors of dna gyrase b and topoisomerase iv, part i: structure guided discovery and optimization of dual targeting agents with potent, broad-spectrum enzymatic activity. | | Descriptor: | (3R)-1-[5-chloro-6-ethyl-2-(pyrido[2,3-b]pyrazin-7-ylsulfanyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl]pyrrolidin-3-amine, DNA gyrase subunit B, TERTIARY-BUTYL ALCOHOL | | Authors: | Bensen, D.C, Trzoss, M, Tari, L.W. | | Deposit date: | 2012-11-12 | | Release date: | 2013-02-13 | | Last modified: | 2024-02-28 | | Method: | X-RAY DIFFRACTION (1.69 Å) | | Cite: | Pyrrolopyrimidine inhibitors of DNA gyrase B (GyrB) and topoisomerase IV (ParE). Part I: Structure guided discovery and optimization of dual targeting agents with potent, broad-spectrum enzymatic activity.
Bioorg.Med.Chem.Lett., 23, 2013
|
|
5AAG
 | | Aurora A kinase bound to an imidazopyridine inhibitor (14b) | | Descriptor: | AURORA KINASE A, [3-[[4-[6-chloranyl-2-(1,3-dimethylpyrazol-4-yl)-3H-imidazo[4,5-b]pyridin-7-yl]pyrazol-1-yl]methyl]phenyl]-(4-methylpiperazin-1-yl)methanone | | Authors: | McIntyre, P.J, Bayliss, R. | | Deposit date: | 2015-07-24 | | Release date: | 2015-09-02 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.85 Å) | | Cite: | 7-(Pyrazol-4-Yl)-3H-Imidazo[4,5-B]Pyridine-Based Derivatives for Kinase Inhibition: Co-Crystallisation Studies with Aurora-A Reveal Distinct Differences in the Orientation of the Pyrazole N1-Substituent.
Bioorg.Med.Chem.Lett., 25, 2015
|
|
5AAE
 | | Aurora A kinase bound to an imidazopyridine inhibitor (14d) | | Descriptor: | 3-((4-(6-chloro-2-(1,3-dimethyl-1H-pyrazol-4-yl)-3H-imidazo[4,5-b]pyridin-7-yl)-1H-pyrazol-1-yl)methyl)-5-methylisoxazole, AURORA KINASE A | | Authors: | McIntyre, P.J, Bayliss, R. | | Deposit date: | 2015-07-24 | | Release date: | 2015-09-02 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (3.11 Å) | | Cite: | 7-(Pyrazol-4-Yl)-3H-Imidazo[4,5-B]Pyridine-Based Derivatives for Kinase Inhibition: Co-Crystallisation Studies with Aurora-A Reveal Distinct Differences in the Orientation of the Pyrazole N1-Substituent.
Bioorg.Med.Chem.Lett., 25, 2015
|
|
5AAD
 | | Aurora A kinase bound to an imidazopyridine inhibitor (7a) | | Descriptor: | 7-(1-benzyl-1H-pyrazol-4-yl)-6-chloro-2-(1,3-dimethyl-1H-pyrazol-4-yl)-3H-imidazo[4,5-b]pyridine, AURORA KINASE A, SULFATE ION | | Authors: | McIntyre, P.J, Kosmopoulou, M, Bayliss, R. | | Deposit date: | 2015-07-24 | | Release date: | 2015-09-02 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (3.1 Å) | | Cite: | 7-(Pyrazol-4-Yl)-3H-Imidazo[4,5-B]Pyridine-Based Derivatives for Kinase Inhibition: Co-Crystallisation Studies with Aurora-A Reveal Distinct Differences in the Orientation of the Pyrazole N1-Substituent.
Bioorg.Med.Chem.Lett., 25, 2015
|
|
5AAF
 | | Aurora A kinase bound to an imidazopyridine inhibitor (14a) | | Descriptor: | 3-((4-(6-chloro-2-(1,3-dimethyl-1H-pyrazol-4-yl)-3H-imidazo[4,5-b]pyridin-7-yl)-1H-pyrazol-1-yl)methyl)-N,N-dimethylbenzamide, AURORA KINASE A | | Authors: | McIntyre, P.J, Bayliss, R. | | Deposit date: | 2015-07-24 | | Release date: | 2015-09-02 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.78 Å) | | Cite: | 7-(Pyrazol-4-Yl)-3H-Imidazo[4,5-B]Pyridine-Based Derivatives for Kinase Inhibition: Co-Crystallisation Studies with Aurora-A Reveal Distinct Differences in the Orientation of the Pyrazole N1-Substituent.
Bioorg.Med.Chem.Lett., 25, 2015
|
|
1R7W
 | | NMR STRUCTURE OF THE R(GGAGGACAUCCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUCCCU BULGE | | Descriptor: | 34-MER | | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | | Deposit date: | 2003-10-22 | | Release date: | 2004-05-25 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,).
Biochemistry, 43, 2004
|
|
1R7Z
 | | NMR STRUCTURE OF THE R(GGAGGACAUUCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUUCCU BULGE | | Descriptor: | 34-MER | | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | | Deposit date: | 2003-10-22 | | Release date: | 2004-05-25 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,).
Biochemistry, 43, 2004
|
|
2KRU
 | | Solution NMR structure of the PCP_red domain of light-independent protochlorophyllide reductase subunit B from Chlorobium tepidum. Northeast Structural Genomics Consortium Target CtR69A | | Descriptor: | Light-independent protochlorophyllide reductase subunit B | | Authors: | He, Y, Eletsky, A, Lee, D, Ciccosanti, C, Janjua, H, Acton, T.B, Xiao, R, Everett, J.K, Montelione, G.T, Szyperski, T, Northeast Structural Genomics Consortium (NESG) | | Deposit date: | 2009-12-22 | | Release date: | 2010-02-16 | | Last modified: | 2024-05-08 | | Method: | SOLUTION NMR | | Cite: | Solution NMR structure of the PCP_red domain of light-independent protochlorophyllide reductase subunit B from Chlorobium tepidum. Northeast Structural Genomics Consortium Target CtR69A
To be Published
|
|
3MCU
 | | Crystal structure of the dipicolinate synthase chain B from Bacillus cereus. Northeast Structural Genomics Consortium Target BcR215. | | Descriptor: | Dipicolinate synthase, B chain, PHOSPHATE ION | | Authors: | Vorobiev, S, Lew, S, Abashidze, M, Seetharaman, J, Wang, H, Ciccosanti, C, Foote, E.L, Mao, L, Xiao, R, Acton, T.B, Montelione, G.T, Hunt, J.F, Tong, L, Northeast Structural Genomics Consortium (NESG) | | Deposit date: | 2010-03-29 | | Release date: | 2010-04-14 | | Last modified: | 2023-11-22 | | Method: | X-RAY DIFFRACTION (2.303 Å) | | Cite: | Crystal structure of the dipicolinate synthase chain B from Bacillus cereus.
To be Published
|
|
3GPB
 | |
1ZYS
 | | Co-crystal structure of Checkpoint Kinase Chk1 with a pyrrolo-pyridine inhibitor | | Descriptor: | N-{5-[4-(4-METHYLPIPERAZIN-1-YL)PHENYL]-1H-PYRROLO[2,3-B]PYRIDIN-3-YL}NICOTINAMIDE, SULFATE ION, Serine/threonine-protein kinase Chk1, ... | | Authors: | Stavenger, R.A, Zhao, B, Zhou, B.-B.S, Brown, M.J, Lee, D, Holt, D.A. | | Deposit date: | 2005-06-10 | | Release date: | 2006-06-13 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (1.7 Å) | | Cite: | Pyrrolo[2,3-b]pyridines Inhibit the Checkpoint Kinase Chk1
To be Published
|
|
4B0G
 | | Complex of Aurora-A bound to an Imidazopyridine-based inhibitor | | Descriptor: | 6-bromo-2-(1-methyl-1H-imidazol-5-yl)-7-{4-[(5-methyl-1,2-oxazol-3-yl)methyl]piperazin-1-yl}-1H-imidazo[4,5-b]pyridine, AURORA KINASE A, SULFATE ION | | Authors: | Kosmopoulou, M, Bayliss, R. | | Deposit date: | 2012-07-02 | | Release date: | 2013-03-13 | | Last modified: | 2023-12-20 | | Method: | X-RAY DIFFRACTION (2.5 Å) | | Cite: | Optimization of Imidazo[4,5-B]Pyridine-Based Kinase Inhibitors: Identification of a Dual Flt3/Aurora Kinase Inhibitor as an Orally Bioavailable Preclinical Development Candidate for the Treatment of Acute Myeloid Leukemia.
J.Med.Chem., 55, 2012
|
|
3BP9
 | | Structure of B-tropic MLV capsid N-terminal domain | | Descriptor: | GLYCEROL, Gag protein, ISOPROPYL ALCOHOL | | Authors: | Gulnahar, M.B, Dodding, M.P, Goldstone, D.C, Haire, L.F, Stoye, J.P, Taylor, I.A. | | Deposit date: | 2007-12-18 | | Release date: | 2008-02-12 | | Last modified: | 2023-11-01 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Structure of B-MLV capsid amino-terminal domain reveals key features of viral tropism, gag assembly and core formation
J.Mol.Biol., 376, 2008
|
|
4HFX
 | | Crystal structure of a transcription elongation factor B polypeptide 3 from Homo sapiens, Northeast Structural Genomics consortium target id HR4748B. | | Descriptor: | SULFATE ION, Transcription elongation factor B polypeptide 3 | | Authors: | Seetharaman, J, Su, M, Ciccosanti, C, Sahdev, S, Acton, T.B, Xiao, R, Everett, J.K, Montelione, G.T, Hunt, J.F, Tong, L, Northeast Structural Genomics Consortium (NESG) | | Deposit date: | 2012-10-05 | | Release date: | 2012-12-12 | | Last modified: | 2018-01-24 | | Method: | X-RAY DIFFRACTION (2.54 Å) | | Cite: | Crystal structure of a transcription elongation factor B polypeptide 3 from Homo sapiens, Northeast Structural Genomics consortium target id HR4748B. (CASP Target)
TO BE PUBLISHED
|
|
3CVK
 | | Crystal structure of HCV NS5B polymerase with a novel pyridazinone inhibitor | | Descriptor: | N-{3-[1-(3,3-Dimethyl-butyl)-4-hydroxy-2-oxo-1,2,4a,5,6,7-hexahydro-pyrrolo[1,2-b]pyridazin-3-yl]-1,1-dioxo-1,2-dihydro -1lambda6-benzo[1,2,4]thiadiazin-7-yl}-methanesulfonamide, RNA-directed RNA polymerase | | Authors: | Zhao, Q, Showalter, R.E, Han, Q, Kissinger, C.R. | | Deposit date: | 2008-04-18 | | Release date: | 2009-04-21 | | Last modified: | 2024-04-03 | | Method: | X-RAY DIFFRACTION (2.31 Å) | | Cite: | Hexahydro-pyrrolo- and hexahydro-1H-pyrido[1,2-b]pyridazin-2-ones as potent inhibitors of HCV NS5B polymerase.
Bioorg.Med.Chem.Lett., 18, 2008
|
|
4O3Z
 | | Crystal structure of the vaccine antigen Transferrin Binding Protein B (TbpB) mutant Tyr-95-Ala from Actinobacillus pleuropneumoniae H87 | | Descriptor: | ACETATE ION, GLYCEROL, Outer membrane protein; transferrin-binding protein | | Authors: | Calmettes, C, Yu, R.H, Schryvers, A.B, Moraes, T.F. | | Deposit date: | 2013-12-18 | | Release date: | 2015-01-14 | | Last modified: | 2015-03-04 | | Method: | X-RAY DIFFRACTION (2.9 Å) | | Cite: | Nonbinding site-directed mutants of transferrin binding protein B exhibit enhanced immunogenicity and protective capabilities.
Infect.Immun., 83, 2015
|
|
4O3Y
 | | Crystal structure of the vaccine antigen Transferrin Binding Protein B (TbpB) mutant Arg-179-Glu from Actinobacillus pleuropneumoniae H87 | | Descriptor: | ACETATE ION, GLYCEROL, Outer membrane protein; transferrin-binding protein | | Authors: | Calmettes, C, Yu, R.H, Schryvers, A.B, Moraes, T.F. | | Deposit date: | 2013-12-18 | | Release date: | 2015-01-14 | | Last modified: | 2015-03-04 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Nonbinding site-directed mutants of transferrin binding protein B exhibit enhanced immunogenicity and protective capabilities.
Infect.Immun., 83, 2015
|
|
4O4U
 | | Crystal structure of the vaccine antigen Transferrin Binding Protein B (TbpB) mutant Trp-176-Ala from Haemophilus parasuis Hp5 | | Descriptor: | GLYCEROL, TbpB | | Authors: | Calmettes, C, Yu, R.H, Schryvers, A.B, Moraes, T.F. | | Deposit date: | 2013-12-19 | | Release date: | 2015-01-14 | | Last modified: | 2015-03-04 | | Method: | X-RAY DIFFRACTION (2.64 Å) | | Cite: | Nonbinding site-directed mutants of transferrin binding protein B exhibit enhanced immunogenicity and protective capabilities.
Infect.Immun., 83, 2015
|
|
4O49
 | | Crystal structure of the vaccine antigen Transferrin Binding Protein B (TbpB) mutant Tyr-174-Ala from Actinobacillus pleuropneumoniae H87 | | Descriptor: | ACETATE ION, GLYCEROL, Outer membrane protein; transferrin-binding protein | | Authors: | Calmettes, C, Yu, R.H, Schryvers, A.B, Moraes, T.F. | | Deposit date: | 2013-12-18 | | Release date: | 2015-01-14 | | Last modified: | 2015-03-04 | | Method: | X-RAY DIFFRACTION (2.5 Å) | | Cite: | Nonbinding site-directed mutants of transferrin binding protein B exhibit enhanced immunogenicity and protective capabilities.
Infect.Immun., 83, 2015
|
|
1QCX
 | | PECTIN LYASE B | | Descriptor: | PECTIN LYASE B | | Authors: | Vitali, J, Jurnak, F. | | Deposit date: | 1999-05-13 | | Release date: | 1999-05-19 | | Last modified: | 2024-04-03 | | Method: | X-RAY DIFFRACTION (1.7 Å) | | Cite: | The tree-dimensional structure of aspergillus niger pectin lyase B at 1.7-A resolution.
Plant Physiol., 116, 1998
|
|
3EJ1
 | | CDK2/CyclinA complexed with a pyrazolopyridazine inhibitor | | Descriptor: | Cell division protein kinase 2, Cyclin-A2, N-cyclopropyl-4-pyrazolo[1,5-b]pyridazin-3-ylpyrimidin-2-amine | | Authors: | Stevens, K, Reno, M, Alberti, J, Price, D, Kane-Carson, L, Knick, V, Shewchuk, L, Hassell, A, Veal, J, Peel, M. | | Deposit date: | 2008-09-17 | | Release date: | 2008-10-21 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (3.22 Å) | | Cite: | Synthesis and evaluation of pyrazolo[1,5-b]pyridazines as selective cyclin dependent kinase inhibitors.
Bioorg.Med.Chem.Lett., 18, 2008
|
|
3EID
 | | CDK2/CyclinA complexed with a pyrazolopyridazine inhibitor | | Descriptor: | (2S)-1-(dimethylamino)-3-(4-{[4-(6-morpholin-4-ylpyrazolo[1,5-b]pyridazin-3-yl)pyrimidin-2-yl]amino}phenoxy)propan-2-ol, Cell division protein kinase 2, Cyclin-A2 | | Authors: | Steven, K, Reno, M, Alberti, J, Price, D, Kane-Carson, L, Knick, V, Shewchuk, L, Hassell, A, Veal, J, Peel, M. | | Deposit date: | 2008-09-15 | | Release date: | 2008-10-21 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (3.15 Å) | | Cite: | Synthesis and evaluation of pyrazolo[1,5-b]pyridazines as selective cyclin dependent kinase inhibitors.
Bioorg.Med.Chem.Lett., 18, 2008
|
|
