7POO
 
 | | Crystal structure of profragilysin-3 (proBFT-3) from Bacteroides fragilis in complex with foliosidine in P212121. | | Descriptor: | ACETATE ION, BFT-3, PROLINE, ... | | Authors: | Eckhard, U, Guevara, T, Gomis-Ruth, F.X. | | Deposit date: | 2021-09-09 | | Release date: | 2022-09-14 | | Last modified: | 2024-01-31 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Repositioning small molecule drugs as allosteric inhibitors of the BFT-3 toxin from enterotoxigenic Bacteroides fragilis.
Protein Sci., 31, 2022
|
|
7POL
 | | Crystal structure of profragilysin-3 (proBFT-3) from Bacteroides fragilis in complex with flumequine | | Descriptor: | (12~{R})-7-fluoranyl-12-methyl-4-oxidanylidene-1-azatricyclo[7.3.1.0^{5,13}]trideca-2,5(13),6,8-tetraene-3-carboxylic acid, BFT-3, CHLORIDE ION, ... | | Authors: | Eckhard, U, Guevara, T, Gomis-Ruth, F.X. | | Deposit date: | 2021-09-09 | | Release date: | 2022-09-14 | | Last modified: | 2024-01-31 | | Method: | X-RAY DIFFRACTION (1.95 Å) | | Cite: | Repositioning small molecule drugs as allosteric inhibitors of the BFT-3 toxin from enterotoxigenic Bacteroides fragilis.
Protein Sci., 31, 2022
|
|
3DKX
 | | Crystal Structure of the replication initiator protein encoded on plasmid pMV158 (RepB), trigonal form, to 2.7 Ang resolution | | Descriptor: | CHLORIDE ION, MAGNESIUM ION, MANGANESE (II) ION, ... | | Authors: | Boer, D.R, Ruiz-Maso, J.A, Blanco, A.G, Vives-Llacer, M, Uson, I, Gomis-Ruth, F.X, Espinosa, M, Del Solar, G, Coll, M. | | Deposit date: | 2008-06-26 | | Release date: | 2009-06-30 | | Last modified: | 2024-03-20 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Plasmid replication initiator RepB forms a hexamer reminiscent of ring helicases and has mobile nuclease domains
Embo J., 28, 2009
|
|
3DKY
 | | Crystal Structure of the replication initiator protein encoded on plasmid pMV158 (RepB), tetragonal form, to 3.6 Ang resolution | | Descriptor: | MANGANESE (II) ION, Replication protein repB | | Authors: | Boer, D.R, Ruiz-Maso, J.A, Blanco, A.G, Vives-Llacer, M, Uson, I, Gomis-Ruth, F.X, Espinosa, M, Del Solar, G, Coll, M. | | Deposit date: | 2008-06-26 | | Release date: | 2009-06-30 | | Last modified: | 2023-11-01 | | Method: | X-RAY DIFFRACTION (3.6 Å) | | Cite: | Plasmid replication initiator RepB forms a hexamer reminiscent of ring helicases and has mobile nuclease domains
Embo J., 28, 2009
|
|
1SAX
 | | Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA | | Descriptor: | 5'-d(CAAAATTACAACTGTAATATCGGAG)-3', 5'-d(GCTCCGATATTACAGTTGTAATTTT)-3', Methicillin resistance regulatory protein mecI, ... | | Authors: | Garcia-Castellanos, R, Mallorqui-Fernandez, G, Marrero, A, Potempa, J, Coll, M, Gomis-Ruth, F.X. | | Deposit date: | 2004-02-09 | | Release date: | 2004-04-27 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | On the transcriptional regulation of methicillin resistance: MecI repressor in complex with its operator
J.Biol.Chem., 279, 2004
|
|
3H8T
 | | Structure of Porphyromonas gingivalis heme-binding protein HmuY in complex with Heme | | Descriptor: | GLYCEROL, HmuY, PROTOPORPHYRIN IX CONTAINING FE, ... | | Authors: | Wojtowicz, H, Guevara, T, Tallant, C, Olczak, M, Sroka, A, Potempa, J, Sola, M, Olczak, T, Gomis-Ruth, F.X. | | Deposit date: | 2009-04-29 | | Release date: | 2009-05-12 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Unique structure and stability of HmuY, a novel heme-binding protein of Porphyromonas gingivalis
Plos Pathog., 5, 2009
|
|
4IN9
 | | Structure of karilysin MMP-like catalytic domain in complex with inhibitory tetrapeptide SWFP | | Descriptor: | GLYCEROL, Karilysin protease, POTASSIUM ION, ... | | Authors: | Guevara, T, Ksiazek, M, Skottrup, P.D, Cerda-Costa, N, Trillo-Muyo, S, de Diego, I, Riise, E, Potempa, J, Gomis-Ruth, F.X. | | Deposit date: | 2013-01-04 | | Release date: | 2013-05-15 | | Last modified: | 2023-09-20 | | Method: | X-RAY DIFFRACTION (1.55 Å) | | Cite: | Structure of the catalytic domain of the Tannerella forsythia matrix metallopeptidase karilysin in complex with a tetrapeptidic inhibitor.
Acta Crystallogr.,Sect.F, 69, 2013
|
|
4QHF
 | | Crystal structure of Methanocaldococcus jannaschii monomeric selecase | | Descriptor: | GLYCEROL, NICKEL (II) ION, Uncharacterized protein MJ1213 | | Authors: | Lopez-pelegrin, M, Cerda-costa, N, Cintas-pedrola, A, Herranz-trillo, F, Bernado, P, Peinado, J.R, Arolas, J.L, Gomis-ruth, F.X. | | Deposit date: | 2014-05-28 | | Release date: | 2014-07-16 | | Last modified: | 2024-04-03 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Multiple stable conformations account for reversible concentration-dependent oligomerization and autoinhibition of a metamorphic metallopeptidase
Angew.Chem.Int.Ed.Engl., 53, 2014
|
|
4QHI
 | | Crystal structure of Methanocaldococcus jannaschii selecase mutant R36W | | Descriptor: | CHLORIDE ION, GLYCEROL, Uncharacterized protein MJ1213, ... | | Authors: | Lopez-pelegrin, M, Cerda-costa, N, Cintas-pedrola, A, Herranz-trillo, F, Bernado, P, Peinado, J.R, Arolas, J.L, Gomis-ruth, F.X. | | Deposit date: | 2014-05-28 | | Release date: | 2014-07-16 | | Last modified: | 2024-04-03 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Multiple stable conformations account for reversible concentration-dependent oligomerization and autoinhibition of a metamorphic metallopeptidase
Angew.Chem.Int.Ed.Engl., 53, 2014
|
|
4QHJ
 | | Crystal structure of Methanocaldococcus jannaschii selecase mutant I100F+H107F | | Descriptor: | ACETATE ION, GLYCEROL, Uncharacterized protein MJ1213, ... | | Authors: | Lopez-pelegrin, M, Cerda-costa, N, Cintas-pedrola, A, Herranz-trillo, F, Bernado, P, Peinado, J.R, Arolas, J.L, Gomis-ruth, F.X. | | Deposit date: | 2014-05-28 | | Release date: | 2014-07-16 | | Last modified: | 2024-04-03 | | Method: | X-RAY DIFFRACTION (1.75 Å) | | Cite: | Multiple stable conformations account for reversible concentration-dependent oligomerization and autoinhibition of a metamorphic metallopeptidase
Angew.Chem.Int.Ed.Engl., 53, 2014
|
|
4QHG
 | | Crystal structure of Methanocaldococcus jannaschii dimeric selecase | | Descriptor: | GLYCEROL, Uncharacterized protein MJ1213, ZINC ION | | Authors: | Lopez-pelegrin, M, Cerda-costa, N, Cintas-pedrola, A, Herranz-trillo, F, Bernado, P, Peinado, J.R, Arolas, J.L, Gomis-ruth, F.X. | | Deposit date: | 2014-05-28 | | Release date: | 2014-07-16 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Multiple stable conformations account for reversible concentration-dependent oligomerization and autoinhibition of a metamorphic metallopeptidase
Angew.Chem.Int.Ed.Engl., 53, 2014
|
|
4QHH
 | | Crystal structure of Methanocaldococcus jannaschii tetrameric selecase | | Descriptor: | GLYCEROL, SODIUM ION, Uncharacterized protein MJ1213, ... | | Authors: | Lopez-pelegrin, M, Cerda-costa, N, Cintas-pedrola, A, Herranz-trillo, F, Bernado, P, Peinado, J.R, Arolas, J.L, Gomis-ruth, F.X. | | Deposit date: | 2014-05-28 | | Release date: | 2014-07-16 | | Last modified: | 2024-04-03 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Multiple stable conformations account for reversible concentration-dependent oligomerization and autoinhibition of a metamorphic metallopeptidase
Angew.Chem.Int.Ed.Engl., 53, 2014
|
|
4RBM
 | | Porphyromonas gingivalis gingipain K (Kgp) catalytic and immunoglobulin superfamily-like domains | | Descriptor: | (3S)-3,7-diaminoheptan-2-one, ACETATE ION, AZIDE ION, ... | | Authors: | de Diego, I, Veillard, F, Sztukowska, M.N, Guevara, T, Potempa, B, Pomowski, A, Huntington, J.A, Potempa, J, Gomis-Ruth, F.X. | | Deposit date: | 2014-09-12 | | Release date: | 2014-10-08 | | Last modified: | 2023-11-15 | | Method: | X-RAY DIFFRACTION (1.75 Å) | | Cite: | Structure and Mechanism of Cysteine Peptidase Gingipain K (Kgp), a Major Virulence Factor of Porphyromonas gingivalis in Periodontitis.
J.Biol.Chem., 289, 2014
|
|
4R3V
 | | Structure of karilysin propeptide and catalytic MMP domain | | Descriptor: | CALCIUM ION, GLYCEROL, Karilysin, ... | | Authors: | Lopez-Pelegrin, M, Ksiazek, M, Karim, A.Y, Guevara, T, Arolas, J.L, Potempa, J, Gomis-Ruth, F.X. | | Deposit date: | 2014-08-18 | | Release date: | 2015-01-07 | | Last modified: | 2023-09-20 | | Method: | X-RAY DIFFRACTION (2.01 Å) | | Cite: | A novel mechanism of latency in matrix metalloproteinases.
J.Biol.Chem., 290, 2015
|
|
1NQ6
 | | Crystal Structure of the catalytic domain of xylanase A from Streptomyces halstedii JM8 | | Descriptor: | MAGNESIUM ION, Xys1 | | Authors: | Canals, A, Vega, M.C, Gomis-Ruth, F.X, Santamaria, R.I, Coll, M. | | Deposit date: | 2003-01-21 | | Release date: | 2004-01-21 | | Last modified: | 2023-10-25 | | Method: | X-RAY DIFFRACTION (1.78 Å) | | Cite: | Structure of xylanase Xys1delta from Streptomyces halstedii.
Acta Crystallogr.,Sect.D, 59, 2003
|
|
1OKR
 | | Three-dimensional structure of S.aureus methicillin-resistance regulating transcriptional repressor MecI. | | Descriptor: | CHLORIDE ION, GLYCEROL, METHICILLIN RESISTANCE REGULATORY PROTEIN MECI | | Authors: | Garcia-Castellanos, R, Marrero, A, Mallorqui-Fernandez, G, Potempa, J, Coll, M, Gomis-Ruth, F.X. | | Deposit date: | 2003-07-28 | | Release date: | 2003-10-09 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Three-Dimensional Structure of Meci: Molecular Basis for Transcriptional Regulation of Staphylococcal Methicillin Resistance
J.Biol.Chem., 278, 2003
|
|
4YU5
 | | Crystal structure of selenomethionine variant of Bacillus anthracis immune inhibitor A2 peptidase zymogen | | Descriptor: | 3-(1-methylpiperidinium-1-yl)propane-1-sulfonate, CALCIUM ION, GLYCEROL, ... | | Authors: | Arolas, J.L, Goulas, T, Gomis-Ruth, F.X. | | Deposit date: | 2015-03-18 | | Release date: | 2015-10-28 | | Last modified: | 2016-01-20 | | Method: | X-RAY DIFFRACTION (2.9 Å) | | Cite: | Structural Basis for Latency and Function of Immune Inhibitor A Metallopeptidase, a Modulator of the Bacillus anthracis Secretome.
Structure, 24, 2016
|
|
4YTG
 | | Crystal structure of Porphyromonas gingivalis peptidylarginine deiminase (PPAD) mutant C351A in complex with dipeptide Met-Arg. | | Descriptor: | ARGININE, AZIDE ION, CHLORIDE ION, ... | | Authors: | Goulas, T, Mizgalska, D, Garcia-Ferrer, I, Kantyka, T, Guevara, T, Szmigielski, B, Sroka, A, Millan, C, Uson, I, Veillard, F, Potempa, B, Mydel, P, Sola, M, Potempa, J, Gomis-Ruth, F.X. | | Deposit date: | 2015-03-17 | | Release date: | 2015-07-01 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Structure and mechanism of a bacterial host-protein citrullinating virulence factor, Porphyromonas gingivalis peptidylarginine deiminase.
Sci Rep, 5, 2015
|
|
4YU6
 | | Crystal structure of Bacillus anthracis immune inhibitor A2 peptidase zymogen | | Descriptor: | ACETONITRILE, CALCIUM ION, Immune inhibitor A, ... | | Authors: | Arolas, J.L, Goulas, T, Gomis-Ruth, F.X. | | Deposit date: | 2015-03-18 | | Release date: | 2015-10-28 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Structural Basis for Latency and Function of Immune Inhibitor A Metallopeptidase, a Modulator of the Bacillus anthracis Secretome.
Structure, 24, 2016
|
|
5AG8
 | | CRYSTAL STRUCTURE OF A MUTANT (665I6H) OF THE C-TERMINAL DOMAIN OF RGPB | | Descriptor: | GINGIPAIN R2, GLYCEROL, SULFATE ION | | Authors: | de Diego, I, Ksiazek, M, Mizgalska, D, Golik, P, Szmigielski, B, Nowak, M, Nowakowska, Z, Potempa, B, Koneru, L, Nguyen, K.A, Enghild, J, Thogersen, I.B, Dubin, G, Gomis-Ruth, F.X, Potempa, J. | | Deposit date: | 2015-01-29 | | Release date: | 2016-04-06 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | The Outer-Membrane Export Signal of Porphyromonas Gingivalis Type Ix Secretion System (T9Ss) is a Conserved C-Terminal Beta-Sandwich Domain.
Sci.Rep., 6, 2016
|
|
5A42
 | | Cryo-EM single particle 3D reconstruction of the native conformation of E. coli alpha-2-macroglobulin (ECAM) | | Descriptor: | UNCHARACTERIZED LIPOPROTEIN YFHM | | Authors: | Garcia-Ferrer, I, Arede, P, Gomez-Blanco, J, Luque, D, Duquerroy, S, Caston, J.R, Goulas, T, Gomis-Ruth, F.X. | | Deposit date: | 2015-06-04 | | Release date: | 2015-07-29 | | Last modified: | 2024-05-08 | | Method: | ELECTRON MICROSCOPY (16 Å) | | Cite: | Structural and Functional Insights Into Escherichia Coli Alpha2- Macroglobulin Endopeptidase Snap-Trap Inhibition.
Proc.Natl.Acad.Sci.USA, 112, 2015
|
|
5AG9
 | | CRYSTAL STRUCTURE OF A MUTANT (665sXa) C-TERMINAL DOMAIN OF RGPB | | Descriptor: | Gingipain R2, SULFATE ION | | Authors: | de Diego, I, Ksiazek, M, Mizgalska, D, Golik, P, Szmigielski, B, Nowak, M, Nowakowska, Z, Potempa, B, Koneru, L, Nguyen, K.A, Enghild, J, Thogersen, I.B, Dubin, G, Gomis-Ruth, F.X, Potempa, J. | | Deposit date: | 2015-01-29 | | Release date: | 2016-04-06 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.11 Å) | | Cite: | The outer-membrane export signal of Porphyromonas gingivalis type IX secretion system (T9SS) is a conserved C-terminal beta-sandwich domain.
Sci Rep, 6, 2016
|
|
5A24
 | | Crystal structure of Dionain-1, the major endopeptidase in the Venus flytrap digestive juice | | Descriptor: | DIONAIN-1, N-[N-[1-HYDROXYCARBOXYETHYL-CARBONYL]LEUCYLAMINO-BUTYL]-GUANIDINE, PHOSPHATE ION | | Authors: | Risor, M.W, Thomsen, L.R, Sanggaard, K.W, Nielsen, T.A, Thogersen, I.B, Lukassen, M.V, Rossen, L, Garcia-Ferrer, I, Guevara, T, Meinjohanns, E, Nielsen, N.C, Gomis-Ruth, F.X, Enghild, J.J. | | Deposit date: | 2015-05-12 | | Release date: | 2015-12-09 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (1.5 Å) | | Cite: | Enzymatic and Structural Characterization of the Major Endopeptidase in the Venus Flytrap Digestion Fluid.
J.Biol.Chem., 291, 2016
|
|
2IWA
 | | Unbound glutaminyl cyclotransferase from Carica papaya. | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, CALCIUM ION, GLUTAMINE CYCLOTRANSFERASE, ... | | Authors: | Guevara, T, Mallorqui-Fernandez, N, Garcia-Castellanos, R, Petersen, G.E, Lauritzen, C, Pedersen, J, Arnau, J, Gomis-Ruth, F.X, Sola, M. | | Deposit date: | 2006-06-27 | | Release date: | 2006-07-04 | | Last modified: | 2020-07-29 | | Method: | X-RAY DIFFRACTION (1.6 Å) | | Cite: | Papaya Glutamine Cyclotransferase Shows a Singular Five-Fold Beta-Propeller Architecture that Suggests a Novel Reaction Mechanism.
Biol.Chem., 387, 2006
|
|
2IYN
 | | The co-factor-induced pre-active conformation in PhoB | | Descriptor: | MAGNESIUM ION, PHOSPHATE REGULON TRANSCRIPTIONAL REGULATORY PROTEIN PHOB | | Authors: | Sola, M, Drew, D.L, Blanco, A.G, Gomis-Ruth, F.X, Coll, M. | | Deposit date: | 2006-07-19 | | Release date: | 2006-08-30 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (2.08 Å) | | Cite: | The Cofactor-Induced Pre-Active Conformation in Phob.
Acta Crystallogr.,Sect.D, 62, 2006
|
|
