4IHV
Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)
Summary for 4IHV
Entry DOI | 10.2210/pdb4ihv/pdb |
Related | 4IHW 4IHX 4IHY |
Descriptor | DNA-binding protein fis, 27-bp DNA Strand A, 27-bp DNA Strand B, ... (4 entities in total) |
Functional Keywords | protein-dna complex, hth domain, minor groove compression, dna bending, indirect recognition, transcription-dna complex, transcription/dna |
Biological source | Escherichia coli |
Total number of polymer chains | 4 |
Total formula weight | 39093.61 |
Authors | Hancock, S.P.,Cascio, D.,Johnson, R.C. (deposition date: 2012-12-19, release date: 2013-05-01, Last modification date: 2023-09-20) |
Primary citation | Hancock, S.P.,Ghane, T.,Cascio, D.,Rohs, R.,Di Felice, R.,Johnson, R.C. Control of DNA minor groove width and Fis protein binding by the purine 2-amino group. Nucleic Acids Res., 41:6750-6760, 2013 Cited by PubMed: 23661683DOI: 10.1093/nar/gkt357 PDB entries with the same primary citation |
Experimental method | X-RAY DIFFRACTION (2.716 Å) |
Structure validation
Download full validation report